ID: 1157028944

View in Genome Browser
Species Human (GRCh38)
Location 18:43881069-43881091
Sequence CTCAGGCCTGAAGAATCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157028944_1157028952 27 Left 1157028944 18:43881069-43881091 CCTACTGATTCTTCAGGCCTGAG No data
Right 1157028952 18:43881119-43881141 TGATCTTCCACTTTAAAGTTGGG No data
1157028944_1157028951 26 Left 1157028944 18:43881069-43881091 CCTACTGATTCTTCAGGCCTGAG No data
Right 1157028951 18:43881118-43881140 TTGATCTTCCACTTTAAAGTTGG No data
1157028944_1157028948 -2 Left 1157028944 18:43881069-43881091 CCTACTGATTCTTCAGGCCTGAG No data
Right 1157028948 18:43881090-43881112 AGTTTGGTGCCTTCTTTGGTAGG No data
1157028944_1157028947 -6 Left 1157028944 18:43881069-43881091 CCTACTGATTCTTCAGGCCTGAG No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157028944 Original CRISPR CTCAGGCCTGAAGAATCAGT AGG (reversed) Intergenic
No off target data available for this crispr