ID: 1157028947

View in Genome Browser
Species Human (GRCh38)
Location 18:43881086-43881108
Sequence CCTGAGTTTGGTGCCTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157028944_1157028947 -6 Left 1157028944 18:43881069-43881091 CCTACTGATTCTTCAGGCCTGAG No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data
1157028941_1157028947 2 Left 1157028941 18:43881061-43881083 CCTAGAGCCCTACTGATTCTTCA No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data
1157028940_1157028947 11 Left 1157028940 18:43881052-43881074 CCAACTCAACCTAGAGCCCTACT No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data
1157028943_1157028947 -5 Left 1157028943 18:43881068-43881090 CCCTACTGATTCTTCAGGCCTGA No data
Right 1157028947 18:43881086-43881108 CCTGAGTTTGGTGCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157028947 Original CRISPR CCTGAGTTTGGTGCCTTCTT TGG Intergenic
No off target data available for this crispr