ID: 1157028949

View in Genome Browser
Species Human (GRCh38)
Location 18:43881099-43881121
Sequence TCAAGGATGCCTACCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157028949_1157028954 17 Left 1157028949 18:43881099-43881121 CCTTCTTTGGTAGGCATCCTTGA No data
Right 1157028954 18:43881139-43881161 GGGTTTGATGTATTCTATAATGG No data
1157028949_1157028952 -3 Left 1157028949 18:43881099-43881121 CCTTCTTTGGTAGGCATCCTTGA No data
Right 1157028952 18:43881119-43881141 TGATCTTCCACTTTAAAGTTGGG No data
1157028949_1157028951 -4 Left 1157028949 18:43881099-43881121 CCTTCTTTGGTAGGCATCCTTGA No data
Right 1157028951 18:43881118-43881140 TTGATCTTCCACTTTAAAGTTGG No data
1157028949_1157028955 18 Left 1157028949 18:43881099-43881121 CCTTCTTTGGTAGGCATCCTTGA No data
Right 1157028955 18:43881140-43881162 GGTTTGATGTATTCTATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157028949 Original CRISPR TCAAGGATGCCTACCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr