ID: 1157030772

View in Genome Browser
Species Human (GRCh38)
Location 18:43905082-43905104
Sequence TCAAGCAGCTTGTAAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157030772_1157030774 24 Left 1157030772 18:43905082-43905104 CCTGTATTTTACAAGCTGCTTGA No data
Right 1157030774 18:43905129-43905151 CAATTGCATCTTCTACCAAATGG No data
1157030772_1157030775 25 Left 1157030772 18:43905082-43905104 CCTGTATTTTACAAGCTGCTTGA No data
Right 1157030775 18:43905130-43905152 AATTGCATCTTCTACCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157030772 Original CRISPR TCAAGCAGCTTGTAAAATAC AGG (reversed) Intergenic
No off target data available for this crispr