ID: 1157037277

View in Genome Browser
Species Human (GRCh38)
Location 18:43990011-43990033
Sequence CCCCACCATATGAAAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157037277_1157037287 0 Left 1157037277 18:43990011-43990033 CCAGGGCCTTTCATATGGTGGGG No data
Right 1157037287 18:43990034-43990056 GGATGGGGAGGGATAATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157037277 Original CRISPR CCCCACCATATGAAAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr