ID: 1157037281

View in Genome Browser
Species Human (GRCh38)
Location 18:43990017-43990039
Sequence CCATCCCCCCACCATATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157037281_1157037287 -6 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037287 18:43990034-43990056 GGATGGGGAGGGATAATATTAGG No data
1157037281_1157037290 27 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037290 18:43990067-43990089 AATGTAAATGACGAGTTAATGGG No data
1157037281_1157037289 26 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037289 18:43990066-43990088 TAATGTAAATGACGAGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157037281 Original CRISPR CCATCCCCCCACCATATGAA AGG (reversed) Intergenic