ID: 1157037287

View in Genome Browser
Species Human (GRCh38)
Location 18:43990034-43990056
Sequence GGATGGGGAGGGATAATATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157037281_1157037287 -6 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037287 18:43990034-43990056 GGATGGGGAGGGATAATATTAGG No data
1157037277_1157037287 0 Left 1157037277 18:43990011-43990033 CCAGGGCCTTTCATATGGTGGGG No data
Right 1157037287 18:43990034-43990056 GGATGGGGAGGGATAATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157037287 Original CRISPR GGATGGGGAGGGATAATATT AGG Intergenic
No off target data available for this crispr