ID: 1157037289

View in Genome Browser
Species Human (GRCh38)
Location 18:43990066-43990088
Sequence TAATGTAAATGACGAGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23277
Summary {0: 3401, 1: 4646, 2: 2884, 3: 2471, 4: 9875}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157037281_1157037289 26 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037289 18:43990066-43990088 TAATGTAAATGACGAGTTAATGG 0: 3401
1: 4646
2: 2884
3: 2471
4: 9875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157037289 Original CRISPR TAATGTAAATGACGAGTTAA TGG Intergenic
Too many off-targets to display for this crispr