ID: 1157037290

View in Genome Browser
Species Human (GRCh38)
Location 18:43990067-43990089
Sequence AATGTAAATGACGAGTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28824
Summary {0: 3240, 1: 4686, 2: 3070, 3: 8538, 4: 9290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157037281_1157037290 27 Left 1157037281 18:43990017-43990039 CCTTTCATATGGTGGGGGGATGG No data
Right 1157037290 18:43990067-43990089 AATGTAAATGACGAGTTAATGGG 0: 3240
1: 4686
2: 3070
3: 8538
4: 9290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157037290 Original CRISPR AATGTAAATGACGAGTTAAT GGG Intergenic
Too many off-targets to display for this crispr