ID: 1157041945

View in Genome Browser
Species Human (GRCh38)
Location 18:44050117-44050139
Sequence CAGCTAGGTGTACCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157041941_1157041945 6 Left 1157041941 18:44050088-44050110 CCACAACCAAAATAGATTAATGT No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041936_1157041945 24 Left 1157041936 18:44050070-44050092 CCAGACCCAAATGTTTCCCCACA No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041939_1157041945 8 Left 1157041939 18:44050086-44050108 CCCCACAACCAAAATAGATTAAT No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041938_1157041945 18 Left 1157041938 18:44050076-44050098 CCAAATGTTTCCCCACAACCAAA No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041937_1157041945 19 Left 1157041937 18:44050075-44050097 CCCAAATGTTTCCCCACAACCAA No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041943_1157041945 0 Left 1157041943 18:44050094-44050116 CCAAAATAGATTAATGTAGGTAG No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data
1157041940_1157041945 7 Left 1157041940 18:44050087-44050109 CCCACAACCAAAATAGATTAATG No data
Right 1157041945 18:44050117-44050139 CAGCTAGGTGTACCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157041945 Original CRISPR CAGCTAGGTGTACCTCCCAG TGG Intergenic
No off target data available for this crispr