ID: 1157044412

View in Genome Browser
Species Human (GRCh38)
Location 18:44082022-44082044
Sequence CACCATTTTCAGTTGTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157044412_1157044414 -5 Left 1157044412 18:44082022-44082044 CCGTGGGACAACTGAAAATGGTG No data
Right 1157044414 18:44082040-44082062 TGGTGTAACCTACATGTAACGGG No data
1157044412_1157044413 -6 Left 1157044412 18:44082022-44082044 CCGTGGGACAACTGAAAATGGTG No data
Right 1157044413 18:44082039-44082061 ATGGTGTAACCTACATGTAACGG No data
1157044412_1157044416 12 Left 1157044412 18:44082022-44082044 CCGTGGGACAACTGAAAATGGTG No data
Right 1157044416 18:44082057-44082079 AACGGGAAGACCAGAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157044412 Original CRISPR CACCATTTTCAGTTGTCCCA CGG (reversed) Intergenic
No off target data available for this crispr