ID: 1157046536

View in Genome Browser
Species Human (GRCh38)
Location 18:44107097-44107119
Sequence TCTCCATGGGACCCAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157046527_1157046536 13 Left 1157046527 18:44107061-44107083 CCTGTCCACAAAAGCCAAAATGC No data
Right 1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG No data
1157046530_1157046536 -9 Left 1157046530 18:44107083-44107105 CCATTGACCAGCCTTCTCCATGG No data
Right 1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG No data
1157046529_1157046536 -1 Left 1157046529 18:44107075-44107097 CCAAAATGCCATTGACCAGCCTT No data
Right 1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG No data
1157046528_1157046536 8 Left 1157046528 18:44107066-44107088 CCACAAAAGCCAAAATGCCATTG No data
Right 1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157046536 Original CRISPR TCTCCATGGGACCCAGGTGA AGG Intergenic
No off target data available for this crispr