ID: 1157048489

View in Genome Browser
Species Human (GRCh38)
Location 18:44132083-44132105
Sequence GAGTTTCCATAGTCTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157048482_1157048489 14 Left 1157048482 18:44132046-44132068 CCTCTCAAGATTTAAAGGCTATT No data
Right 1157048489 18:44132083-44132105 GAGTTTCCATAGTCTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157048489 Original CRISPR GAGTTTCCATAGTCTTCACT GGG Intergenic
No off target data available for this crispr