ID: 1157052624

View in Genome Browser
Species Human (GRCh38)
Location 18:44185006-44185028
Sequence TGGAATCCTCTAAAAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157052624_1157052627 16 Left 1157052624 18:44185006-44185028 CCTACTCCTTTTAGAGGATTCCA No data
Right 1157052627 18:44185045-44185067 AAGTAATCTATGTCTACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157052624 Original CRISPR TGGAATCCTCTAAAAGGAGT AGG (reversed) Intergenic
No off target data available for this crispr