ID: 1157063555

View in Genome Browser
Species Human (GRCh38)
Location 18:44321169-44321191
Sequence CAGCTCGGACAGCTTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157063549_1157063555 5 Left 1157063549 18:44321141-44321163 CCTGCTTGGCCTGCTACAGGGCG 0: 1
1: 4
2: 15
3: 34
4: 284
Right 1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG No data
1157063545_1157063555 16 Left 1157063545 18:44321130-44321152 CCATGCCATATCCTGCTTGGCCT 0: 1
1: 2
2: 10
3: 46
4: 238
Right 1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG No data
1157063551_1157063555 -4 Left 1157063551 18:44321150-44321172 CCTGCTACAGGGCGGCCTTCAGC 0: 1
1: 0
2: 14
3: 21
4: 108
Right 1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG No data
1157063546_1157063555 11 Left 1157063546 18:44321135-44321157 CCATATCCTGCTTGGCCTGCTAC 0: 1
1: 0
2: 5
3: 33
4: 165
Right 1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157063555 Original CRISPR CAGCTCGGACAGCTTGGTGT TGG Intergenic
No off target data available for this crispr