ID: 1157065447

View in Genome Browser
Species Human (GRCh38)
Location 18:44343787-44343809
Sequence CAAGATAACCACACTCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157065447_1157065450 13 Left 1157065447 18:44343787-44343809 CCAAAATGAGTGTGGTTATCTTG No data
Right 1157065450 18:44343823-44343845 CCAAGAGATATGCAAAGTGTGGG No data
1157065447_1157065452 27 Left 1157065447 18:44343787-44343809 CCAAAATGAGTGTGGTTATCTTG No data
Right 1157065452 18:44343837-44343859 AAGTGTGGGGTAATGTCAGAAGG No data
1157065447_1157065451 14 Left 1157065447 18:44343787-44343809 CCAAAATGAGTGTGGTTATCTTG No data
Right 1157065451 18:44343824-44343846 CAAGAGATATGCAAAGTGTGGGG No data
1157065447_1157065448 12 Left 1157065447 18:44343787-44343809 CCAAAATGAGTGTGGTTATCTTG No data
Right 1157065448 18:44343822-44343844 GCCAAGAGATATGCAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157065447 Original CRISPR CAAGATAACCACACTCATTT TGG (reversed) Intergenic
No off target data available for this crispr