ID: 1157066288

View in Genome Browser
Species Human (GRCh38)
Location 18:44354756-44354778
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 3, 1: 5, 2: 6, 3: 6, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157066288 Original CRISPR CAATATTAGATCAACGAGAC AGG (reversed) Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907856538 1:58309018-58309040 CAATATGAGATGAGAGAGACTGG + Intronic
911695553 1:100887190-100887212 CAATATTGGATAAAAGAGAAAGG - Intronic
912423301 1:109563099-109563121 CAAAATTAGAACACTGAGACTGG + Intronic
912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG + Intergenic
917362604 1:174193552-174193574 CAATATTAGTTTAAGGAGACAGG - Intronic
922747955 1:228057531-228057553 GGATATTAGATAAACTAGACTGG + Intronic
1064197353 10:13256142-13256164 AAATAAGAGATCAACGAGAAAGG - Intergenic
1068049863 10:51936053-51936075 CAATATTTGTTCAAGGAAACTGG + Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1080735334 11:35008565-35008587 CAATATTAGATGAAGCAAACGGG + Intronic
1081067927 11:38570657-38570679 AACTATTAGATCAAACAGACCGG + Intergenic
1086863837 11:91956449-91956471 CAATATTAGTTCAAAGATATGGG - Intergenic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1107865430 13:44698718-44698740 CCATTTTAGATCAACCAGAAAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1117256350 14:53981766-53981788 CAATATTGAATCAATGAGACTGG - Intergenic
1120187038 14:81404199-81404221 TAATTTTAGATCAAAGAGAAAGG - Intronic
1120710911 14:87792347-87792369 CAACACTAGAGCAATGAGACCGG + Intergenic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127317599 15:57812691-57812713 CAATATTAGATCAACCATACAGG - Intergenic
1128854793 15:71000748-71000770 CTAAATTAGATCACGGAGACAGG - Intronic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1133339805 16:5028805-5028827 CAATATTGGCTGAATGAGACAGG + Intronic
1138534276 16:57651705-57651727 CAATATCAGATCATGAAGACTGG + Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1144119052 17:12132177-12132199 CCATATTAGATCAGCTATACTGG - Intronic
1151039172 17:70838927-70838949 CAATATTAGGTCAACTTGATTGG + Intergenic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
927784825 2:25966404-25966426 CAATATAAGAGCAGCTAGACAGG - Intronic
928918147 2:36496437-36496459 CTATATTAGATGAAAGAAACAGG - Intronic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
948187606 2:236033974-236033996 CATTATGAGATCAACTCGACAGG - Intronic
1169189751 20:3650754-3650776 CAGAATTAGTTCAACGAAACAGG - Exonic
1169976050 20:11329140-11329162 CAATGTTAGACCAAAGAGGCCGG + Intergenic
1177868680 21:26544024-26544046 CAATATTAGATAAGGGAGATTGG + Intronic
1181846470 22:25713396-25713418 TTATAATAGATCAATGAGACTGG + Intronic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
954723057 3:52582270-52582292 CAATATTATATGACCAAGACAGG - Intronic
959305694 3:104662992-104663014 CAAGTTTAGATAAAGGAGACTGG + Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
965356468 3:167680330-167680352 TAAAATTAGATCAACAAGAATGG + Intergenic
971035236 4:22685693-22685715 TTATTTTAGATCAACTAGACTGG - Intergenic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978611216 4:110542631-110542653 AAATATTAGCTCAAGGAGGCAGG - Intronic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
989254500 5:39351641-39351663 CTATATTTTATCAAAGAGACTGG - Intronic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
991213969 5:64140154-64140176 CAATAATAGAAAAACCAGACAGG + Intergenic
995049254 5:107683914-107683936 CAATCTTAGAGCAAGAAGACAGG + Intergenic
995907192 5:117139612-117139634 CAATTTTATATCAACAATACAGG - Intergenic
999168643 5:149573639-149573661 GAACATTAGCTCAATGAGACAGG + Intronic
1001913305 5:175538987-175539009 AAATAGTAGATCAAGGAGCCAGG - Intergenic
1002689995 5:181044055-181044077 CAATTTTAGCTCTAGGAGACAGG + Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1006281403 6:33056765-33056787 CAATGTTGGATCAAAAAGACTGG - Intergenic
1010426693 6:75735597-75735619 CTATCTTAGATCAATGAGGCAGG - Intergenic
1011995094 6:93576714-93576736 AGATATTAGATCAACGAGGAAGG - Intergenic
1019841610 7:3451673-3451695 CAATATTTGATTAACAATACAGG + Intronic
1032824137 7:135552691-135552713 CAATAATGGATCAATTAGACTGG + Intergenic
1034199180 7:149271236-149271258 CAATATAAAATCAAAGAGCCAGG - Intronic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1046528394 8:115411691-115411713 GAATATTAGAGCTACGCGACAGG + Exonic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1188015516 X:25103871-25103893 TAATTTTAGGTCAACTAGACCGG - Intergenic
1189385491 X:40533769-40533791 CAATATTAGATAAAATAGGCCGG + Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1193805439 X:85988070-85988092 CAATATTCAATCAAGGATACTGG - Intronic
1195990542 X:110677987-110678009 CTATATTAAATCAATGAGACGGG - Intronic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1196810157 X:119622475-119622497 CAATTTCAGACCAACGAGTCAGG - Intronic
1197581814 X:128293659-128293681 CAATATTTTAGCAAAGAGACTGG + Intergenic