ID: 1157070885

View in Genome Browser
Species Human (GRCh38)
Location 18:44406702-44406724
Sequence AAGTTAGCTGCTAATCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157070885_1157070886 5 Left 1157070885 18:44406702-44406724 CCATTAAGATTAGCAGCTAACTT No data
Right 1157070886 18:44406730-44406752 CAAAAACAATGAAGACTAAAAGG No data
1157070885_1157070887 11 Left 1157070885 18:44406702-44406724 CCATTAAGATTAGCAGCTAACTT No data
Right 1157070887 18:44406736-44406758 CAATGAAGACTAAAAGGCAGTGG No data
1157070885_1157070888 12 Left 1157070885 18:44406702-44406724 CCATTAAGATTAGCAGCTAACTT No data
Right 1157070888 18:44406737-44406759 AATGAAGACTAAAAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157070885 Original CRISPR AAGTTAGCTGCTAATCTTAA TGG (reversed) Intergenic
No off target data available for this crispr