ID: 1157070886

View in Genome Browser
Species Human (GRCh38)
Location 18:44406730-44406752
Sequence CAAAAACAATGAAGACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157070885_1157070886 5 Left 1157070885 18:44406702-44406724 CCATTAAGATTAGCAGCTAACTT No data
Right 1157070886 18:44406730-44406752 CAAAAACAATGAAGACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157070886 Original CRISPR CAAAAACAATGAAGACTAAA AGG Intergenic