ID: 1157070888 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:44406737-44406759 |
| Sequence | AATGAAGACTAAAAGGCAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1157070885_1157070888 | 12 | Left | 1157070885 | 18:44406702-44406724 | CCATTAAGATTAGCAGCTAACTT | No data | ||
| Right | 1157070888 | 18:44406737-44406759 | AATGAAGACTAAAAGGCAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1157070888 | Original CRISPR | AATGAAGACTAAAAGGCAGT GGG | Intergenic | ||