ID: 1157070888

View in Genome Browser
Species Human (GRCh38)
Location 18:44406737-44406759
Sequence AATGAAGACTAAAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157070885_1157070888 12 Left 1157070885 18:44406702-44406724 CCATTAAGATTAGCAGCTAACTT No data
Right 1157070888 18:44406737-44406759 AATGAAGACTAAAAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157070888 Original CRISPR AATGAAGACTAAAAGGCAGT GGG Intergenic