ID: 1157082862

View in Genome Browser
Species Human (GRCh38)
Location 18:44546729-44546751
Sequence AGGACAAGTTCTATCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157082862_1157082867 13 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082867 18:44546765-44546787 TTCCTTTTTGTTGTAGCAGGGGG No data
1157082862_1157082870 30 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082870 18:44546782-44546804 AGGGGGTTCTTTACAGGACTAGG No data
1157082862_1157082869 24 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082869 18:44546776-44546798 TGTAGCAGGGGGTTCTTTACAGG No data
1157082862_1157082864 10 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082864 18:44546762-44546784 TTTTTCCTTTTTGTTGTAGCAGG No data
1157082862_1157082866 12 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082866 18:44546764-44546786 TTTCCTTTTTGTTGTAGCAGGGG No data
1157082862_1157082865 11 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082865 18:44546763-44546785 TTTTCCTTTTTGTTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157082862 Original CRISPR AGGACAAGTTCTATCCTTAG AGG (reversed) Intergenic
No off target data available for this crispr