ID: 1157082868

View in Genome Browser
Species Human (GRCh38)
Location 18:44546767-44546789
Sequence AACCCCCTGCTACAACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157082868_1157082870 -8 Left 1157082868 18:44546767-44546789 CCTTTTTGTTGTAGCAGGGGGTT No data
Right 1157082870 18:44546782-44546804 AGGGGGTTCTTTACAGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157082868 Original CRISPR AACCCCCTGCTACAACAAAA AGG (reversed) Intergenic
No off target data available for this crispr