ID: 1157082870

View in Genome Browser
Species Human (GRCh38)
Location 18:44546782-44546804
Sequence AGGGGGTTCTTTACAGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157082862_1157082870 30 Left 1157082862 18:44546729-44546751 CCTCTAAGGATAGAACTTGTCCT No data
Right 1157082870 18:44546782-44546804 AGGGGGTTCTTTACAGGACTAGG No data
1157082863_1157082870 10 Left 1157082863 18:44546749-44546771 CCTTTTTCTTTTTTTTTTCCTTT 0: 3
1: 136
2: 1848
3: 30943
4: 49671
Right 1157082870 18:44546782-44546804 AGGGGGTTCTTTACAGGACTAGG No data
1157082868_1157082870 -8 Left 1157082868 18:44546767-44546789 CCTTTTTGTTGTAGCAGGGGGTT No data
Right 1157082870 18:44546782-44546804 AGGGGGTTCTTTACAGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157082870 Original CRISPR AGGGGGTTCTTTACAGGACT AGG Intergenic
No off target data available for this crispr