ID: 1157083160

View in Genome Browser
Species Human (GRCh38)
Location 18:44550259-44550281
Sequence AGAATCACTGAACCTATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157083160_1157083162 14 Left 1157083160 18:44550259-44550281 CCCTACATAGGTTCAGTGATTCT No data
Right 1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157083160 Original CRISPR AGAATCACTGAACCTATGTA GGG (reversed) Intergenic
No off target data available for this crispr