ID: 1157083161

View in Genome Browser
Species Human (GRCh38)
Location 18:44550260-44550282
Sequence TAGAATCACTGAACCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157083161_1157083162 13 Left 1157083161 18:44550260-44550282 CCTACATAGGTTCAGTGATTCTA No data
Right 1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157083161 Original CRISPR TAGAATCACTGAACCTATGT AGG (reversed) Intergenic
No off target data available for this crispr