ID: 1157083162

View in Genome Browser
Species Human (GRCh38)
Location 18:44550296-44550318
Sequence ATCAAGAAATTGCCTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157083161_1157083162 13 Left 1157083161 18:44550260-44550282 CCTACATAGGTTCAGTGATTCTA No data
Right 1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG No data
1157083160_1157083162 14 Left 1157083160 18:44550259-44550281 CCCTACATAGGTTCAGTGATTCT No data
Right 1157083162 18:44550296-44550318 ATCAAGAAATTGCCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157083162 Original CRISPR ATCAAGAAATTGCCTCCATT TGG Intergenic
No off target data available for this crispr