ID: 1157085558

View in Genome Browser
Species Human (GRCh38)
Location 18:44577061-44577083
Sequence GGCAATGGAGAGGATATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157085558_1157085571 20 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085571 18:44577104-44577126 TGGACCTGCGGGATGGGAGCAGG No data
1157085558_1157085565 0 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085565 18:44577084-44577106 TTTTCTGTGAAATGAGGGCCTGG No data
1157085558_1157085562 -6 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085562 18:44577078-44577100 ATTGCCTTTTCTGTGAAATGAGG No data
1157085558_1157085567 9 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085567 18:44577093-44577115 AAATGAGGGCCTGGACCTGCGGG No data
1157085558_1157085569 14 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085569 18:44577098-44577120 AGGGCCTGGACCTGCGGGATGGG No data
1157085558_1157085566 8 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085566 18:44577092-44577114 GAAATGAGGGCCTGGACCTGCGG No data
1157085558_1157085563 -5 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085563 18:44577079-44577101 TTGCCTTTTCTGTGAAATGAGGG No data
1157085558_1157085568 13 Left 1157085558 18:44577061-44577083 CCCTCTATATCCTCTCCATTGCC No data
Right 1157085568 18:44577097-44577119 GAGGGCCTGGACCTGCGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157085558 Original CRISPR GGCAATGGAGAGGATATAGA GGG (reversed) Intergenic
No off target data available for this crispr