ID: 1157093112

View in Genome Browser
Species Human (GRCh38)
Location 18:44659960-44659982
Sequence CCTTTCAACCATGAAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157093108_1157093112 22 Left 1157093108 18:44659915-44659937 CCCTACATGGGCTGTAACCATAC No data
Right 1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG No data
1157093109_1157093112 21 Left 1157093109 18:44659916-44659938 CCTACATGGGCTGTAACCATACT No data
Right 1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG No data
1157093110_1157093112 5 Left 1157093110 18:44659932-44659954 CCATACTTGTAATGATCACTTAG No data
Right 1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157093112 Original CRISPR CCTTTCAACCATGAAATGTC AGG Intergenic
No off target data available for this crispr