ID: 1157096374

View in Genome Browser
Species Human (GRCh38)
Location 18:44688976-44688998
Sequence ATACACTGCCCACTCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157096374_1157096376 4 Left 1157096374 18:44688976-44688998 CCCTGGGAGAGTGGGCAGTGTAT 0: 1
1: 0
2: 3
3: 20
4: 143
Right 1157096376 18:44689003-44689025 AGATACGTGCTTTGCTGAAATGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157096374 Original CRISPR ATACACTGCCCACTCTCCCA GGG (reversed) Intronic
901089787 1:6633523-6633545 TTACACTGCCCACTCACACCAGG - Exonic
901197659 1:7449150-7449172 AGACACAGCCCATGCTCCCAGGG - Intronic
901449768 1:9328923-9328945 AGACATTGCCAAATCTCCCAGGG + Intronic
902619815 1:17644304-17644326 ACACACTTCACACTCTGCCAGGG - Intronic
904493259 1:30873081-30873103 CTTCTCTGCCCTCTCTCCCAAGG - Intronic
906546386 1:46622199-46622221 ATAAACCTCCCTCTCTCCCAGGG - Intergenic
908727852 1:67196089-67196111 ATCAACTGCCCTCTCTCTCAGGG - Intronic
910549995 1:88464811-88464833 ATTAACTGCCCACTCTCACATGG + Intergenic
910645863 1:89514585-89514607 ATTGACCGCCCACTATCCCAAGG + Intergenic
911943326 1:104073974-104073996 TTACACTGCCCACTCACACCAGG - Intergenic
912089284 1:106050652-106050674 ATACTCTGCCCAGTCTACAATGG - Intergenic
915287353 1:154861521-154861543 ACACTCTGCCCCCTCTCCCCGGG + Intronic
916831667 1:168498621-168498643 ATACACTGGGCCCTCTCCCATGG + Intergenic
919738955 1:200971162-200971184 ATTCTCTGCCCACTCTTTCAGGG - Intronic
922871043 1:228902200-228902222 AGACACTGGCCACAATCCCAGGG - Intergenic
923564788 1:235068631-235068653 ACACACTGCCCACTCCTCCTGGG - Intergenic
924039464 1:239970343-239970365 AGACCCTGTCCACTCTCTCAAGG + Intergenic
1067994102 10:51250392-51250414 ACATACTTCCCACTTTCCCATGG - Intronic
1069423779 10:68271676-68271698 AGACATTGCCCAATGTCCCAGGG - Intergenic
1072058593 10:91786607-91786629 ATAAATTGCCCAGTCTCTCAGGG + Intergenic
1075083583 10:119399545-119399567 CTCCACTGGCCACTCTCCTATGG - Intronic
1075967430 10:126624947-126624969 ATAGACTGCCCGCTCTCTGAGGG - Intronic
1076237105 10:128871860-128871882 CTCCGCTGCCCACTCTCCAAGGG - Intergenic
1076536810 10:131183728-131183750 GGACACTGTCCACACTCCCATGG + Intronic
1081566519 11:44264204-44264226 ATCCTCTGCCCACTCTCTCCAGG + Exonic
1081638025 11:44733854-44733876 CTTCCCTGCCCACTCTCACAAGG - Intronic
1083939886 11:65890179-65890201 ATAGACTACCCTCCCTCCCAGGG - Exonic
1089124227 11:116164998-116165020 AGATGCTGCCCTCTCTCCCAAGG + Intergenic
1089654245 11:119935469-119935491 CTACACTGCCATCTATCCCAGGG + Intergenic
1091399870 12:175240-175262 AGACACACCTCACTCTCCCAGGG + Exonic
1096375207 12:51103577-51103599 ATACACACACAACTCTCCCATGG + Intronic
1098081818 12:66794472-66794494 CAACCCTGCTCACTCTCCCAAGG - Intronic
1099949170 12:89281391-89281413 CCAGACTGCCCACACTCCCAGGG + Intergenic
1101236948 12:102799345-102799367 ATCCACTGCCCAGTCCCCCAAGG - Intergenic
1101938926 12:109084448-109084470 AGACACTGCCCAATGTCCCTTGG - Intronic
1101953254 12:109192552-109192574 AGACATTGCCCAATGTCCCAGGG + Intronic
1102942980 12:116960640-116960662 TTCCACTGCCCACTTTCCAATGG - Intronic
1104989157 12:132615493-132615515 GGACACTCCCCACTCTCCCCTGG + Intergenic
1104989197 12:132615616-132615638 GGACACTGTCCACTCTCCCCTGG + Intergenic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1106079636 13:26489542-26489564 ATATACAGCCCACTCTTCCCAGG + Intergenic
1106856285 13:33856835-33856857 ATTCAATGCCCAGTCTCTCAGGG - Intronic
1107117637 13:36764090-36764112 ATACACCTTCCACTCTACCATGG - Intergenic
1107607645 13:42077175-42077197 ATACACTATCCAGTCTCTCAGGG - Intronic
1107960800 13:45556216-45556238 AGACACAGCCTTCTCTCCCATGG - Intronic
1112448273 13:99487006-99487028 CTGCTCTGCCCACTCTCACATGG - Intergenic
1114738808 14:25071908-25071930 ATATAGTGCCCCTTCTCCCAAGG - Intergenic
1124165794 15:27324529-27324551 ATCCAATGCCCACTTTACCATGG - Intronic
1127044979 15:55016385-55016407 ATATTCAGCCCACTCTCCAATGG + Intergenic
1128158744 15:65409294-65409316 AAACACTGCCCTTTCTCCCCTGG - Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1130869081 15:87956083-87956105 ATAGACTACCTACTCTCCCTGGG + Intronic
1133107332 16:3521015-3521037 ACACCCTGCCCACTGTCCCGAGG + Intronic
1133908200 16:10040721-10040743 GCACACTGCACACACTCCCATGG + Intronic
1134608727 16:15591170-15591192 ATCCACTGCCCACGGTCCCAGGG + Intronic
1138163404 16:54777216-54777238 AAACACAGCCCCATCTCCCACGG + Intergenic
1139427792 16:66894026-66894048 CTCCACAGACCACTCTCCCAGGG - Intronic
1141188564 16:81806972-81806994 ATCCACTGCAAACTCTCCCATGG - Intronic
1144358747 17:14470736-14470758 AGACACTGCCCACAATCCTAAGG - Intergenic
1144679048 17:17180695-17180717 ATGCACTGCTCACACCCCCATGG + Intronic
1145250395 17:21294010-21294032 AGACACTGGCCCCTCTCCCCAGG - Intronic
1148240974 17:45999098-45999120 ATACCCTGCCCTGTGTCCCATGG + Intronic
1154112055 18:11578786-11578808 ATACACTGTCTACTTTCCCAAGG - Intergenic
1157096374 18:44688976-44688998 ATACACTGCCCACTCTCCCAGGG - Intronic
1158934566 18:62352761-62352783 CTGCAGTGCCCACTCTTCCAAGG - Intronic
1160273354 18:77408384-77408406 AGACACTGCCCAATGTCCCAAGG - Intergenic
1160305337 18:77728765-77728787 ATTCACTTACCACTCCCCCAGGG + Intergenic
1160426918 18:78783916-78783938 ATACACTCCACACTCACACATGG + Intergenic
1161508509 19:4657453-4657475 AGACACCGCCCACCCGCCCACGG + Intronic
1165008642 19:32826757-32826779 ATAGAGCGCCCACTCTCCGAGGG + Intronic
1165915286 19:39254849-39254871 ACACACTGGCCATTCTACCATGG - Intergenic
1166396659 19:42446177-42446199 ACCCACTGCTCACTTTCCCACGG - Intergenic
925196766 2:1932057-1932079 AGACACTGCCTACACTCCCATGG + Intronic
925451146 2:3969996-3970018 AGGCACTGCCCACCCTCACAGGG + Intergenic
926371773 2:12185928-12185950 AGAGGCTGCCCACTTTCCCATGG + Intergenic
926978665 2:18541990-18542012 TTACACTCCTAACTCTCCCATGG - Intergenic
928067138 2:28175814-28175836 ATACACTGCCCAGGGGCCCAAGG + Intronic
928092593 2:28384669-28384691 ATTCAATCCCAACTCTCCCAGGG + Intergenic
932901358 2:75704601-75704623 AAACGCTGCCCTCTCTCCTAAGG + Intronic
933520939 2:83372829-83372851 ATACACTGCCTTCTCTTCCTGGG + Intergenic
937071695 2:119068411-119068433 CTTCACTGCACTCTCTCCCACGG + Intergenic
939529249 2:143336703-143336725 ATACTCTGCCTCCTCTCCTAGGG - Intronic
942800340 2:179867768-179867790 ATACATTGCCAATTATCCCATGG - Intergenic
944721736 2:202429570-202429592 ATATACTGCCCAATCTCTCTAGG - Intronic
944809763 2:203316565-203316587 TTACACTGTCCACTCTCTTATGG + Intergenic
945319872 2:208408786-208408808 ATATTCTGCCCACAATCCCATGG - Intronic
947927967 2:233938092-233938114 ATCCACTGCTGACTCCCCCAGGG + Intronic
948178512 2:235962168-235962190 ACCCACTTCCCACTCTCCAAGGG - Intronic
948541095 2:238691855-238691877 CCACACTGCTGACTCTCCCAAGG - Intergenic
1170950797 20:20934162-20934184 TTACACAGCCCAGTCTCCGAGGG + Intergenic
1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG + Intronic
1172047580 20:32091558-32091580 ATAAATTTCCCACACTCCCAGGG + Intronic
1179248353 21:39652238-39652260 CCACACTTCCCACTCTCCCTGGG + Intronic
1182253072 22:29017317-29017339 GTACACTGTCCAGTCTGCCACGG + Intronic
1184942185 22:47777111-47777133 ATCCAGTGCCCACTCCGCCACGG + Intergenic
949841216 3:8322134-8322156 ATGCACTGTCCACCTTCCCAGGG - Intergenic
950705841 3:14780983-14781005 TTACACTTCCCATTCTCCCATGG + Intergenic
953666561 3:44930012-44930034 ATGCACTGCCCCCGCTCCCAGGG + Intronic
955310028 3:57876956-57876978 ACAAACTGCCCACTCCCCAAGGG + Intronic
956869149 3:73399400-73399422 AAATTCTGCCCACTCCCCCAGGG + Intronic
957540611 3:81564188-81564210 ATACAATGCCCATCCTCACATGG + Intronic
958552786 3:95637847-95637869 ATACTCTGTCCCCTCTCACATGG + Intergenic
961479861 3:127172722-127172744 ATACAATGCCCCCACTCCCATGG - Intergenic
961485228 3:127211462-127211484 ATAGGCTGCCATCTCTCCCATGG + Intergenic
964361879 3:155907339-155907361 ATCCACTTTCCAGTCTCCCAAGG - Intronic
964633510 3:158837322-158837344 CTGCACTGCTGACTCTCCCATGG - Intergenic
966452082 3:180074165-180074187 ATACACTCCCCTCTGGCCCAGGG - Intergenic
967198675 3:187051663-187051685 CAACACTCCCCACTCTCCCCTGG - Intronic
967994217 3:195154586-195154608 ACACACTGCGCTCCCTCCCAAGG + Intronic
970604616 4:17667526-17667548 ATCCACTGCCCACTGTGCCCAGG + Intronic
970771353 4:19615827-19615849 ATACACTGCCCTAGGTCCCAAGG + Intergenic
970797425 4:19929965-19929987 ATAAAATGCCCACTCTTCCATGG + Intergenic
970846384 4:20543312-20543334 CTGCACTGCCCACGCTCCCTTGG + Intronic
971167830 4:24202671-24202693 GGACACTGCCCACTCTCCCTGGG + Intergenic
972355263 4:38274557-38274579 ATCCACTCCCCTGTCTCCCAGGG - Intergenic
976379937 4:84387698-84387720 ATAAAAAGCCCACTTTCCCAGGG - Intergenic
977700468 4:100016284-100016306 AGATACTGCCCCCTCTCCCTTGG + Intergenic
978778017 4:112521789-112521811 ATGGGCTGCCCACTCTCCAATGG + Intergenic
981557408 4:146009806-146009828 ATGCTCTGCAGACTCTCCCAAGG - Intergenic
982724167 4:158887903-158887925 TTACACTGCCCAGTCTCTAATGG + Intronic
984818904 4:183862660-183862682 AAACCCTGCCGACTCTCGCATGG - Intronic
985883695 5:2659630-2659652 AAACACTCCCTACTCTCCAAGGG + Intergenic
987867099 5:23557524-23557546 TTACACTTCTCATTCTCCCAGGG - Intergenic
988903285 5:35756789-35756811 ATACACTTGTCAATCTCCCAGGG - Intronic
993480124 5:88414566-88414588 AAACATTGCCCACTCTCCCAGGG - Intergenic
994935174 5:106245474-106245496 ATACACTGACCCCTCTAACAAGG - Intergenic
995831940 5:116363116-116363138 ATCCACTGGGCACTCACCCATGG + Intronic
997851981 5:137341001-137341023 ATACTCTGCCCACCCCTCCACGG + Intronic
999238196 5:150112691-150112713 ATACAAAGCCCACCATCCCAGGG - Intronic
1000856995 5:166411236-166411258 ATACCCTGCCCCCTCTTTCAAGG - Intergenic
1001857216 5:175023426-175023448 AGACACTGCCAAATGTCCCAGGG + Intergenic
1003458098 6:6302608-6302630 ATTCACTCACCACTCACCCAGGG - Intronic
1005181609 6:23113460-23113482 ATATACTTCCCTCTTTCCCAGGG + Intergenic
1007767702 6:44170799-44170821 CTACTCAGCCCACTCTCACAGGG + Intronic
1008487858 6:52054786-52054808 ATACATTGCCAACTCTTCCCTGG + Intronic
1014716347 6:124868788-124868810 ATACTCTTCCCACTGTGCCAAGG - Intergenic
1016792262 6:148078356-148078378 ATACACTGTACATTCTGCCAAGG + Intergenic
1019808549 7:3147356-3147378 ATACAATGCAAACTATCCCACGG - Intronic
1020714124 7:11648399-11648421 ACACATTGCCCAGACTCCCATGG - Intronic
1024081990 7:45863771-45863793 AGACACTGACCACTGACCCATGG - Intergenic
1024598689 7:50961416-50961438 ATATCCTTCCCAATCTCCCAGGG - Intergenic
1028323411 7:89491282-89491304 ATACACTGCCAATTCAACCATGG - Intergenic
1029063485 7:97824210-97824232 ATACATTGCCCACTCACCCCGGG + Intergenic
1033868538 7:145721358-145721380 ATACACTGCCCTTCCTCTCATGG - Intergenic
1035317266 7:158003973-158003995 AAACACTGGCCAGGCTCCCAAGG - Intronic
1035529142 8:337387-337409 ATCCACTGCGCACTCTGCCCTGG - Intergenic
1036124863 8:6053294-6053316 ATACACAGCCCACTGTCCTCTGG - Intergenic
1037406785 8:18551095-18551117 ATACAGTGCCAACTGTCACAAGG - Intronic
1037676871 8:21058751-21058773 ATTTACAGACCACTCTCCCAGGG + Intergenic
1037718885 8:21424211-21424233 AGACATTGCCAAATCTCCCATGG + Intergenic
1040350377 8:46560775-46560797 AGACATTGCCCACTCACCCTGGG + Intergenic
1040392696 8:46963090-46963112 ATGCACTGCCCCCTCTCACCCGG + Intergenic
1040517158 8:48144523-48144545 ATTTTCTGCCCACTCTCCCACGG - Intergenic
1043408044 8:79959953-79959975 CAACACTGCCAAATCTCCCACGG + Intronic
1044246298 8:89950863-89950885 TTTCACTGCACATTCTCCCAGGG - Intronic
1047178831 8:122567877-122567899 ATACACTGAGCACCCTCCCAAGG + Intergenic
1050670718 9:7993842-7993864 ATACTCTTCCCACTGTGCCAGGG - Intergenic
1051586729 9:18734430-18734452 AGAAAATGCCCACCCTCCCAAGG - Intronic
1056328887 9:85505408-85505430 ATACACTGCACCCTGACCCAGGG + Intergenic
1059964014 9:119595662-119595684 ATAGACTGCCCAAACTCCCAGGG - Intergenic
1187404752 X:18993191-18993213 AGACACTGCCAACTGTCCCAGGG - Intronic
1188860057 X:35244891-35244913 ACACACTGCCCACCCTGCCAAGG - Intergenic
1189170414 X:38903931-38903953 ATACACTGCTTACTCTGCTAGGG - Intergenic
1195829535 X:109040570-109040592 TTACACTGCAATCTCTCCCAAGG + Intergenic
1197654296 X:129099552-129099574 ATCCAGTGCCCACTCTACCCAGG - Intergenic
1199431440 X:147765173-147765195 ATACACTGGCAACTCTCCCAAGG + Intergenic
1200913245 Y:8549331-8549353 CAACACTGGCAACTCTCCCATGG - Intergenic