ID: 1157098119

View in Genome Browser
Species Human (GRCh38)
Location 18:44705727-44705749
Sequence TATACATGGTCCACTGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157098119 Original CRISPR TATACATGGTCCACTGCTTT GGG Intronic
905557452 1:38898486-38898508 TATATGTTGTCCAGTGCTTTTGG - Intronic
924303932 1:242667551-242667573 TCTACATGATCCACAGATTTGGG - Intergenic
1065431859 10:25666531-25666553 TATCCATGTTATACTGCTTTTGG + Intergenic
1070257280 10:74824162-74824184 TAAAGATGGTCTGCTGCTTTGGG - Intergenic
1070274329 10:74990646-74990668 TAAAAATGGTACACTGCATTTGG - Intronic
1071497629 10:86179716-86179738 TAGACATGATGCACTGGTTTGGG - Intronic
1078600824 11:12728896-12728918 TAGCCATGGTCCAATGGTTTGGG - Intronic
1080962213 11:37173931-37173953 TAAACATGGTCTACTGCTGGAGG - Intergenic
1085268340 11:75251394-75251416 TATACAAAGTCCACTCTTTTTGG + Intergenic
1087092361 11:94286582-94286604 TCCACATGTTCCCCTGCTTTGGG - Intergenic
1088369202 11:109071038-109071060 TATACATATGCCACTGCTCTAGG + Intergenic
1088606440 11:111538047-111538069 TATCCATTCTCCACTTCTTTTGG - Intergenic
1091245272 11:134088211-134088233 TAAACATATGCCACTGCTTTTGG - Intronic
1093031090 12:14289101-14289123 ATTACATAGTCCACTGCTATGGG + Intergenic
1093788901 12:23224034-23224056 TATACATGGTCTTCTGGTGTGGG - Intergenic
1094010084 12:25798834-25798856 TACACATGGAGCACTTCTTTAGG - Intergenic
1095493948 12:42765156-42765178 TATTCAGGGTCAACTGTTTTAGG - Intergenic
1102331026 12:112030841-112030863 TATAAATGCACCACTGCTGTTGG - Intronic
1106147507 13:27063300-27063322 CATACATGGCCAACTGATTTTGG + Intergenic
1107719334 13:43231229-43231251 TATAAATGGTCCACGGATGTTGG + Intronic
1109693875 13:65928265-65928287 CATACATGGTCTGTTGCTTTGGG + Intergenic
1111742133 13:92217627-92217649 GATACAGGGACCACTGCTCTGGG - Intronic
1113288887 13:108883900-108883922 CAGACATGGGCCACTGCATTTGG + Intronic
1113691878 13:112316841-112316863 TAGGCATGGACCACTGCTTCAGG + Intergenic
1117591452 14:57272857-57272879 TACACATGGGTAACTGCTTTTGG + Intronic
1134150502 16:11801042-11801064 TCTACATGCACCACTGCATTAGG - Intergenic
1136646115 16:31617251-31617273 TATACAAGGCCCACTCCTATAGG + Intergenic
1145416565 17:22718100-22718122 TAGACATGGTGCACTGGTCTAGG - Intergenic
1150341695 17:64373776-64373798 CATAAATGGTCCCCTTCTTTTGG - Intronic
1156374247 18:36499467-36499489 TAAATCTGGTCCACTTCTTTGGG + Intronic
1157098119 18:44705727-44705749 TATACATGGTCCACTGCTTTGGG + Intronic
1158303143 18:56075373-56075395 TAGACATGAGCCACTGCATTGGG - Intergenic
1158662443 18:59400875-59400897 TATCGATGGACCACTGGTTTAGG - Intergenic
1158707640 18:59807732-59807754 CATCCATGATCCACGGCTTTGGG - Intergenic
1163092018 19:15026845-15026867 TATACATTTTGTACTGCTTTGGG - Intergenic
925598124 2:5577572-5577594 CATACATGGACCAATTCTTTGGG + Intergenic
928805564 2:35147736-35147758 TAGACATGGACCAGTGCTTTTGG - Intergenic
935268857 2:101416465-101416487 TAGACATGGTCCTATGCTGTAGG + Intronic
937387340 2:121447758-121447780 GAAACATGGTCCATTTCTTTGGG - Intronic
938778242 2:134560570-134560592 TCTAAATGGACCACTGCTTTAGG + Intronic
939716741 2:145593333-145593355 AATGTATGGTCCACTGGTTTTGG - Intergenic
941656516 2:168150408-168150430 TATACATGGCACACCTCTTTGGG + Intronic
941865797 2:170333014-170333036 TAGTCATGGTGAACTGCTTTGGG + Intronic
945144214 2:206719631-206719653 TGTGGATGGTCCACTGCTGTGGG - Intergenic
947971435 2:234328615-234328637 AATACCAGGTCCACTGCCTTGGG - Intergenic
1168981598 20:2008670-2008692 TATACCTAGGCCACTGCTTCAGG + Intergenic
1169951524 20:11049561-11049583 TCTATATGGTCCACTCCTTGTGG - Intergenic
1171519875 20:25767488-25767510 TAGACATGGTGCACTGGTCTAGG - Intronic
1171557044 20:26089005-26089027 TAGACATGGTGCACTGGTCTAGG + Intergenic
1176654013 21:9573777-9573799 TAGACATGGTGCACTGGTCTAGG - Intergenic
951271625 3:20631886-20631908 CATACATGGTCTGTTGCTTTGGG - Intergenic
952837117 3:37612700-37612722 CATAAATGGTCAACTTCTTTTGG - Intronic
955148177 3:56340959-56340981 AATAAATGTTCCACTTCTTTGGG + Intronic
963873430 3:150445537-150445559 TATTCATGTTTCACTGCCTTGGG + Intronic
964106513 3:153046305-153046327 TAGCCTTTGTCCACTGCTTTTGG + Intergenic
966282036 3:178242853-178242875 TGCACATGGTCAACTGCCTTTGG - Intergenic
970345900 4:15151753-15151775 CATACATTGTCCACTCCATTTGG + Intergenic
974329819 4:60463916-60463938 TAGCCATGGACCACTGCCTTGGG - Intergenic
974456612 4:62136972-62136994 GATAAATGGTCAAGTGCTTTAGG - Intergenic
975268165 4:72395856-72395878 GATACATGGTCCACAACATTTGG + Intronic
976370567 4:84283911-84283933 TATTAATGGTTCACTGTTTTTGG + Intergenic
977932816 4:102767191-102767213 TATACATGGGCCACTGCACCTGG - Intergenic
985273661 4:188217661-188217683 TTTAAATGCTCCAGTGCTTTAGG - Intergenic
986352109 5:6890038-6890060 TAGGCATGGCCCAGTGCTTTGGG + Intergenic
986500040 5:8389140-8389162 TACCCATTGTCCTCTGCTTTGGG - Intergenic
992699029 5:79321145-79321167 TATAAATGCTCCTGTGCTTTGGG + Intronic
993098012 5:83504037-83504059 TATACATGGTCCACTTTCTAGGG + Intronic
994563826 5:101414205-101414227 CAGACATGAGCCACTGCTTTGGG - Intergenic
1000406044 5:160889379-160889401 TACACATGGTCCACTGCCTGTGG - Intergenic
1001118365 5:168958310-168958332 TATGAATGGTCAACTGCTTGAGG + Intronic
1002622421 5:180497553-180497575 TATGCAAGGTCCACTGGCTTGGG + Intronic
1004212499 6:13664188-13664210 TATACAAAGTCCACTGTATTTGG + Intronic
1005146855 6:22701411-22701433 TCTACATGGTCCACTGGTAAAGG + Intergenic
1008854620 6:56067600-56067622 TCTACATGGTTCACAGTTTTAGG + Intronic
1012162991 6:95911065-95911087 TATATTTGGAGCACTGCTTTTGG - Intergenic
1014698047 6:124648692-124648714 TCTACATGGTCCAATACTTCAGG - Intronic
1016317945 6:142810348-142810370 CATACATAGTCCACATCTTTGGG + Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1020116448 7:5479144-5479166 AATACAAGGTCCACTGTTTCAGG + Intronic
1020508857 7:9027091-9027113 TTTGCATGATCCACTGCTGTGGG - Intergenic
1023191484 7:37587787-37587809 TATACATAGTCCAGTTCTCTTGG + Intergenic
1025280359 7:57622441-57622463 TAGACATGGTGCACTGGTCTAGG - Intergenic
1025304374 7:57843060-57843082 TAGACATGGTGCACTGGTCTAGG + Intergenic
1027586157 7:80061460-80061482 TATACTGGGTCCTCTGCTTAGGG + Intergenic
1027612524 7:80378867-80378889 TACACATTGTCCACTGTTTTGGG - Intronic
1032022192 7:128414058-128414080 TGTAGATGGTCTGCTGCTTTGGG + Intergenic
1035048672 7:155985382-155985404 TGTCCATTGTCCACTGCTTGGGG - Intergenic
1037194243 8:16168017-16168039 TATACATGGTCCTCACCTTAAGG - Intronic
1038589532 8:28824009-28824031 TACACATAGTGAACTGCTTTAGG + Intronic
1040710229 8:50179099-50179121 CATACATGGTCAACTAATTTTGG - Intronic
1042783908 8:72524985-72525007 CTTACAGGGACCACTGCTTTTGG + Intergenic
1046061906 8:109150404-109150426 TATATATTGAGCACTGCTTTTGG + Intergenic
1048341383 8:133541563-133541585 TATACACGGTCCACATGTTTTGG + Intronic
1048644993 8:136410123-136410145 TATATTTAGTCCTCTGCTTTTGG + Intergenic
1050050336 9:1593716-1593738 TATAGATGGTCCATTCCTTGAGG - Intergenic
1050713751 9:8496356-8496378 AATGCATGGTCCACTGCTGTAGG + Intronic
1052547446 9:29898283-29898305 TATACAATGTCTACAGCTTTTGG - Intergenic
1057741496 9:97715733-97715755 TATATATTGTGCACTCCTTTTGG + Intergenic
1058296943 9:103320750-103320772 TATGCATGTTCAACTGCTTTGGG - Intergenic
1203631733 Un_KI270750v1:77229-77251 TAGACATGGTGCACTGGTCTAGG - Intergenic
1194560093 X:95409922-95409944 TATAGATGATCTGCTGCTTTAGG + Intergenic
1197390971 X:125863923-125863945 TCTATCTGGTCCAGTGCTTTTGG - Intergenic