ID: 1157099247

View in Genome Browser
Species Human (GRCh38)
Location 18:44714546-44714568
Sequence CAGCTCTGTGTATTTTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 439}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157099245_1157099247 23 Left 1157099245 18:44714500-44714522 CCTTAGCTCTTCTGTTCTATTAA 0: 1
1: 0
2: 1
3: 24
4: 274
Right 1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG 0: 1
1: 0
2: 3
3: 26
4: 439
1157099244_1157099247 28 Left 1157099244 18:44714495-44714517 CCTGGCCTTAGCTCTTCTGTTCT 0: 1
1: 0
2: 1
3: 31
4: 404
Right 1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG 0: 1
1: 0
2: 3
3: 26
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157099247 Original CRISPR CAGCTCTGTGTATTTTGCAT TGG Intronic
903631460 1:24776263-24776285 CAGAACTGTGAATTTTCCATTGG + Intronic
904682511 1:32239447-32239469 CAGAGCTTTGTATTTTGGATAGG + Intergenic
905997100 1:42390792-42390814 CAGGTTTGTGTATTTTCCCTAGG + Intronic
906228125 1:44138777-44138799 CAGCTCTGTGTCTTCTGTTTTGG + Intergenic
906652790 1:47524795-47524817 CAGCTCTGTGTGTTTGGGGTGGG + Intergenic
906817380 1:48892980-48893002 CAGGTGTGTGTATTTTGAAGGGG - Intronic
906851456 1:49254713-49254735 CAGCTTTGTTCATTTTGCTTAGG - Intronic
906906659 1:49901737-49901759 CAGCTTTGTTCTTTTTGCATAGG - Intronic
906970920 1:50512677-50512699 CAGCTCTGTTCTTTTTGCTTAGG + Intronic
907601811 1:55779451-55779473 TATCTCTGTGTATATTCCATTGG - Intergenic
907636554 1:56140855-56140877 CAGGTATGTGTTTTTTGTATTGG + Intergenic
908326130 1:63025482-63025504 CACCTCTGTGGATTTTCAATGGG - Intergenic
908410282 1:63857550-63857572 TAGCTCTATGGATTTGGCATTGG + Intronic
908613415 1:65888389-65888411 CAGCTTTGTTTCTTTTGCTTAGG + Intronic
908943436 1:69464750-69464772 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
909042920 1:70675479-70675501 CAGCTCTGTGCACCTTGCAGAGG + Intergenic
910203981 1:84729039-84729061 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
910829550 1:91446549-91446571 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
911492264 1:98585061-98585083 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
911540933 1:99157596-99157618 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
911847419 1:102771975-102771997 CAGCTCTGAGAGTTCTGCATTGG - Intergenic
912165121 1:107034382-107034404 CAGCTCTCTGTATTTTGGTATGG + Intergenic
912253144 1:108031604-108031626 CTGCTCTCTGTATTTTCCAGTGG - Intergenic
912464362 1:109860698-109860720 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
912568147 1:110603732-110603754 TAGTGCTGTGTATTTTGCAGAGG - Exonic
915659119 1:157387517-157387539 CAGCTTTGTTTCTTTTGCTTAGG + Intergenic
915817356 1:158982582-158982604 CAGCTTTGTGGTTTCTGCATAGG + Intergenic
915887917 1:159742855-159742877 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
915998907 1:160595411-160595433 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
916848612 1:168679720-168679742 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
917893333 1:179461493-179461515 CAGCTTTGTTCATTTTGCTTAGG + Intronic
918021411 1:180695873-180695895 CAGCTCTGTTCTTTTTGCTTGGG + Intronic
918157664 1:181865185-181865207 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
918219308 1:182421502-182421524 CAGCTTTGTTCATTTTGCTTCGG + Intergenic
918669478 1:187197281-187197303 CAGCTCTGTTGTTTTTGCTTAGG - Intergenic
918877805 1:190071970-190071992 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
919304822 1:195818855-195818877 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
919381190 1:196863348-196863370 CAGCTTTGTGCTTTTTGCTTAGG + Intronic
919528938 1:198691506-198691528 CATCTCTGTCTGTTTTGCTTTGG + Intronic
919730425 1:200910285-200910307 AAGCACTGTGTATATTGCTTTGG + Intronic
920833968 1:209490580-209490602 CAGCACTGTGGATTTTACTTCGG + Intergenic
924834119 1:247631145-247631167 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1062779446 10:188095-188117 CAGTTTTGTGTAATTTGAATAGG + Intronic
1063000100 10:1909229-1909251 CACCTCTGTCTATCCTGCATGGG + Intergenic
1063010529 10:2017969-2017991 CAGCTTTGTATTTTTTGCTTAGG + Intergenic
1063401738 10:5752682-5752704 CAGCTCTGTGGTTTCTGCAGTGG - Intronic
1064461727 10:15541106-15541128 CAGCTCTGTGTGTGCTGCCTAGG + Intronic
1065506296 10:26433270-26433292 GGGCTCTGTGTCTTTTGCTTTGG + Intergenic
1066264587 10:33763847-33763869 CAGCTTTGTGTATTCTACAGAGG - Intergenic
1066555781 10:36611195-36611217 AAACTCAGTTTATTTTGCATAGG + Intergenic
1067127209 10:43528910-43528932 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1067413147 10:46082657-46082679 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1067732983 10:48826410-48826432 CAGCTTTGTTTTTTTTGCTTTGG + Intronic
1068248392 10:54404219-54404241 CAGCTCTGTATTTTTTGCTTAGG - Intronic
1068310610 10:55269829-55269851 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1068736588 10:60420123-60420145 CAGCTCTGTTTATATACCATAGG + Intronic
1069194809 10:65537901-65537923 CAGCTTTGTTGGTTTTGCATAGG - Intergenic
1071199415 10:83201966-83201988 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1072207610 10:93218339-93218361 CATCTCTGTTTATTTTGTATTGG + Intergenic
1072356941 10:94620905-94620927 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1072789563 10:98308422-98308444 CAGCCCAGTGGGTTTTGCATAGG + Intergenic
1073019122 10:100426627-100426649 CAGCTTTGTTCTTTTTGCATGGG - Intergenic
1074180072 10:111053112-111053134 CAGCTCTGTGTAAGTATCATTGG + Intergenic
1077821524 11:5747275-5747297 GAGGTCTGTCTATTTTGCAAAGG - Intronic
1077955057 11:7009130-7009152 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1078453412 11:11457007-11457029 CAGCTCTGAGCGTTGTGCATGGG + Intronic
1078820764 11:14878989-14879011 CAGTTCTGTGTTTTTAGAATTGG + Intronic
1079162454 11:18007841-18007863 CAGCCTTTTGTATTTTGCAGAGG - Intronic
1080037877 11:27728297-27728319 CAGCTCTGTGTCTTTTTACTTGG + Intergenic
1080144666 11:28967149-28967171 CAGCTCTGTTTGTCTTGCCTGGG + Intergenic
1080167550 11:29257523-29257545 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1080188287 11:29518486-29518508 CAAATTTGTGTGTTTTGCATTGG + Intergenic
1080230081 11:30011178-30011200 TAGTGCTGTGTATTTTGCAGAGG - Exonic
1080377652 11:31732597-31732619 CCACTCTGTGTCTTTTGCTTAGG - Intronic
1081211836 11:40345247-40345269 CAGCTTTGTTTATTTTGCTTAGG - Intronic
1081215268 11:40388805-40388827 CATCTCTGTGTTTTTGTCATTGG + Intronic
1081371016 11:42303454-42303476 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1082684097 11:56217223-56217245 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1082720975 11:56675949-56675971 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1082890806 11:58136730-58136752 CAACTCTGTCCATTTTGCAATGG - Intronic
1083527117 11:63379068-63379090 CAGCTTTGTTCATTTTGCTTTGG - Intronic
1084561115 11:69905948-69905970 CTGCTGTGGGTATCTTGCATGGG + Intergenic
1085222480 11:74886765-74886787 CAGCTCTGTTCTTTTTGCTTAGG - Intronic
1087308937 11:96517652-96517674 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1087337180 11:96859135-96859157 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1087930263 11:103968923-103968945 CAGCTCTCTTAAATTTGCATAGG + Intronic
1088060749 11:105646472-105646494 CAGCTCTGTTATTTTTGCTTAGG - Intronic
1089765592 11:120761891-120761913 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1090869111 11:130727012-130727034 CCCTTCTGTGCATTTTGCATTGG + Intergenic
1092321136 12:7476286-7476308 CAGCTCTGTTCTTTTTGCTTAGG - Intronic
1092589595 12:9939170-9939192 CAGCACTCTGTATTTTGTAAAGG - Intergenic
1093188994 12:16053509-16053531 CAGCTTTGTACATTTTGCTTAGG - Intergenic
1094299406 12:28945089-28945111 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1095319954 12:40815092-40815114 CAGCTCTGTTCTTTTTGCTTAGG + Intronic
1095503763 12:42869797-42869819 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1096473941 12:51896608-51896630 CAGATCTGGGTATTTTCCTTAGG - Intergenic
1096894615 12:54808385-54808407 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1097257186 12:57687458-57687480 CAGCTTTGTTTATTTTGCTTAGG - Intergenic
1097359129 12:58638511-58638533 CAGATCTATTTATTTGGCATGGG + Intronic
1097505556 12:60464357-60464379 CATATATGTGTATTTTGCATTGG - Intergenic
1097762934 12:63489554-63489576 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
1099839494 12:87947881-87947903 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
1100362338 12:93890166-93890188 TAGCTGTGTGTATTTTGGATAGG + Intronic
1100872166 12:98921497-98921519 CAGCTCCGTGTGTTTTCTATAGG + Intronic
1102802426 12:115748093-115748115 CAGCTCTGCTTCTTCTGCATAGG - Intergenic
1104317249 12:127714814-127714836 CTGCTCTGTGCATTCTGCAAGGG + Intergenic
1104515021 12:129417248-129417270 CAGCTTTGTTCTTTTTGCATAGG - Intronic
1104707625 12:130959245-130959267 CAGCACTGTGCCTTATGCATAGG + Intronic
1105734933 13:23257989-23258011 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1107214555 13:37901206-37901228 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1108673604 13:52716790-52716812 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1108906570 13:55482173-55482195 CAGCTTTGTGTTTTTTGCTTAGG + Intergenic
1108925901 13:55744153-55744175 CAGCTTTTTGTATTATGCAATGG + Intergenic
1109081239 13:57904014-57904036 CAGCTTTGTGCTTTTTGCCTAGG - Intergenic
1110476343 13:75918767-75918789 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
1110488664 13:76076296-76076318 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1111313591 13:86521435-86521457 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1111369087 13:87292485-87292507 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
1111861972 13:93719025-93719047 CAGCTCTGTTCTTTTTGCTTAGG + Intronic
1112694781 13:101935773-101935795 CATCTCTGTGTGTTTTGTTTTGG - Intronic
1112878353 13:104074288-104074310 CACATCTGTGTATTTAGCCTAGG + Intergenic
1115021478 14:28685805-28685827 CAGCTTTGTACATTTTGCTTTGG + Intergenic
1116008999 14:39328908-39328930 CAGCTTTGTATTTTTTGCTTAGG + Intronic
1116301910 14:43193849-43193871 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1116320703 14:43458762-43458784 CAGCTTTGTTTGTTTTGCTTAGG - Intergenic
1116454282 14:45100282-45100304 AAGCACTGTGTGTTTTGTATGGG + Intronic
1116592507 14:46796347-46796369 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1117577025 14:57109485-57109507 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1118502293 14:66373039-66373061 CAGATTTGTGTAGTTTGGATAGG - Intergenic
1118662178 14:68026799-68026821 CCACTCTGTGTCTTTTACATGGG + Intronic
1118909849 14:70052172-70052194 CAGCTCAGAGTATTAGGCATGGG + Intronic
1119079405 14:71677916-71677938 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1120169787 14:81236621-81236643 CAGCACTGTGTATTTAGCTTGGG + Intergenic
1120748271 14:88173012-88173034 CAGCTCTGTTTCTTTTGCTTAGG - Intergenic
1120819432 14:88898373-88898395 CAGTTCTGAGAATTTTGCTTAGG + Intergenic
1121772977 14:96567628-96567650 CTGCTCTGTGTATTTTGTGATGG + Intergenic
1121784342 14:96644387-96644409 CAGCTTTGTTTTTTTTGCTTGGG + Intergenic
1121942889 14:98090052-98090074 CAGCTGTGTTCTTTTTGCATGGG - Intergenic
1123927470 15:25131729-25131751 CACCTCTGGGTATTTTGTATGGG + Intergenic
1124859283 15:33422611-33422633 CAGTTCTGTGTATTTAGAAAGGG - Intronic
1125402081 15:39314855-39314877 TAGCTCTATGTAGTTTTCATTGG - Intergenic
1126046398 15:44645120-44645142 CAGCTTTGTTCTTTTTGCATAGG - Intronic
1126072899 15:44881726-44881748 TAGTTATGTGTATTTTGCTTCGG - Intergenic
1126772437 15:52071528-52071550 CAACTTTGTGTAATTTGCAAAGG + Intergenic
1127613224 15:60657377-60657399 GAGCTCTGTGGATTCTGCGTCGG - Intronic
1127687281 15:61360572-61360594 CAGCTTTGTTTGTTTTGCTTAGG + Intergenic
1128112156 15:65083430-65083452 CTGCTCTGTTTATTTTCCTTTGG + Intergenic
1128711839 15:69878083-69878105 AAGCACTGTGTATTTTGACTTGG + Intergenic
1130700397 15:86173885-86173907 CAGCTTTGTTCATTTTGCTTAGG + Intronic
1131959864 15:97778229-97778251 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1135418132 16:22284721-22284743 GAGCCCTGTGTTTTGTGCATCGG + Exonic
1139097567 16:63723317-63723339 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1141611568 16:85184134-85184156 CAGCTCTGAGAATTCTGCCTGGG + Intronic
1145125483 17:20296463-20296485 CAGCTTTGTGCTTTTTGCTTAGG + Intronic
1145726978 17:27138592-27138614 CAGCTCTGTATTTTTTGCTTAGG - Intergenic
1148435409 17:47680486-47680508 CAGCTGTGTTTGTTTTGCACAGG + Exonic
1148575949 17:48711363-48711385 CAGCTCTGAGAAATTTGGATGGG - Intergenic
1148817186 17:50337413-50337435 CAGGTCTGTGTCTTGTGCAGTGG - Intergenic
1150593877 17:66586457-66586479 ATGCTCTGTGTCTTTTGCAGTGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153061549 18:1000112-1000134 CAGCCCTGAGTATTATGCAGTGG - Intergenic
1153351798 18:4089500-4089522 CAGCTTTGTTTTTTTTGCTTAGG - Intronic
1153371800 18:4325563-4325585 CAGCTTTGTTTATTTTGCTTAGG - Intronic
1154114628 18:11601580-11601602 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1154288757 18:13085836-13085858 CAGCTTTGTTCATTTTGCCTAGG + Intronic
1154554515 18:15733206-15733228 ATGCTCTGTCTAGTTTGCATGGG - Intergenic
1154911075 18:20651912-20651934 CAGCTCTGTGTAGTTTTTATGGG + Intergenic
1155545396 18:26909384-26909406 CAATTCTGTGTATCTTGGATGGG + Exonic
1155769350 18:29677243-29677265 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1156414647 18:36875113-36875135 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1156686789 18:39659133-39659155 CAGCTCTGTTTGTTTGCCATAGG + Intergenic
1156692174 18:39721373-39721395 CAGCATTGTGTATTGTGCTTGGG - Intergenic
1156937260 18:42725321-42725343 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG + Intronic
1158822871 18:61180963-61180985 CAGCTTTGTTCCTTTTGCATAGG - Intergenic
1159719164 18:71864448-71864470 CAGCTTTGTGGTTTTTGCTTAGG + Intergenic
1161348610 19:3779888-3779910 CAGCTGTGTGAATGTTACATGGG - Intronic
1161563355 19:4985911-4985933 CACCTCTGTGTGTTCTGCACCGG + Intronic
1162214360 19:9120696-9120718 CAGCTTTGTTCCTTTTGCATAGG + Intergenic
1164464770 19:28478198-28478220 CAGCTCTCTGTCTTCTACATTGG - Intergenic
1166263612 19:41661789-41661811 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1168571721 19:57476377-57476399 CACCTCTAAGTATTTTGCACAGG + Intronic
925430848 2:3791703-3791725 CAGCACTGTGTTGTTTGCAGTGG + Intronic
926942211 2:18150658-18150680 TAAGTTTGTGTATTTTGCATGGG + Intronic
927076658 2:19585297-19585319 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
927572119 2:24168875-24168897 TAGCTCAGTGGATTTTGCAAAGG + Intronic
928134459 2:28677821-28677843 CAGCTCCATGTATTTTTCAATGG - Intergenic
928272747 2:29871728-29871750 CAGCTCTATTTATTTTACATAGG + Intronic
929960202 2:46490573-46490595 AGGCTCTGTGCATTTTGCAGGGG + Intergenic
931779952 2:65570702-65570724 CAGCTATGTTCATTTTGCTTGGG + Intergenic
932146258 2:69320412-69320434 CAGCTTTGTATATTTTGAAATGG - Exonic
933221209 2:79691573-79691595 CAGCTTTGTGCTTTTTGCTTAGG - Intronic
933345260 2:81076525-81076547 CAATCCTGTGTATTTTGCAATGG - Intergenic
933360005 2:81269844-81269866 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
933521740 2:83382508-83382530 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
934114900 2:88778779-88778801 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
934549467 2:95247056-95247078 CAGCTTTGTGCTTTTTGCTTAGG - Intronic
936259391 2:110945785-110945807 CAGCTTTGTTCATTTTGCTTAGG + Intronic
936700131 2:115002079-115002101 CAGCTCTGTTCCTTTTGCTTAGG - Intronic
937058537 2:118962161-118962183 CAGCTCTGTTCTTTTTGCTTAGG + Intronic
937544647 2:123002328-123002350 ACGCTCTGTGGATTTTGCAATGG - Intergenic
937814922 2:126240670-126240692 CAGTTCTGTGCATTTTGCACTGG - Intergenic
938261095 2:129895535-129895557 CAGTTCTGAGTATGGTGCATGGG + Intergenic
938564845 2:132509223-132509245 CAGCTCAATGTATGTTGCCTGGG + Intronic
939288187 2:140159595-140159617 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
939521182 2:143232560-143232582 CATCTATGTGTATTTTTAATAGG + Intronic
940641196 2:156345954-156345976 CTGCTCTGAGTATTTAACATAGG - Intergenic
941082135 2:161073974-161073996 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
941117173 2:161485603-161485625 CAGCTTTGTTTATTTTGCTCAGG - Intronic
941515637 2:166472797-166472819 CAGCTTTGTTTTTTTTGCTTAGG + Intronic
941826865 2:169908733-169908755 CAGCTCTGTGAATATTAAATTGG + Intronic
942924497 2:181415828-181415850 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
942977893 2:182041093-182041115 CAGATTTGTTCATTTTGCATAGG + Intronic
943073427 2:183168313-183168335 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
943164809 2:184307671-184307693 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
943245604 2:185446606-185446628 CAACTTTGTTCATTTTGCATAGG - Intergenic
943899019 2:193408130-193408152 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
943962558 2:194285259-194285281 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
944169010 2:196754073-196754095 CAGCTTTGTTCATTTTGCTTAGG + Intronic
945048677 2:205803174-205803196 CAGCTCTCTGCACTTTGCTTTGG - Intergenic
945626415 2:212212616-212212638 CAGCTTTGTTCTTTTTGCATAGG - Intronic
1169663929 20:8012952-8012974 CAGCTCTGAGTCTTTAGCATGGG + Intronic
1169857208 20:10115864-10115886 TAGCTCTTTGCATATTGCATGGG + Intergenic
1170970920 20:21115944-21115966 CAGCTCTGTCTAATTTTCAGAGG - Intergenic
1171042203 20:21775555-21775577 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1171108612 20:22459767-22459789 CTGCTCTGTGTATTTTATGTGGG - Intergenic
1173240551 20:41292935-41292957 CACCTCTGTGTATGTTCAATTGG - Intronic
1173307899 20:41868212-41868234 CAGCTTTGTTTCTTTTGCTTAGG - Intergenic
1173390119 20:42624158-42624180 CTGCTCTGTGAAATTTGCACAGG + Intronic
1173778034 20:45727954-45727976 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1175077239 20:56386064-56386086 CAGGTCTGTATTTTTAGCATAGG + Intronic
1176156006 20:63621050-63621072 CAGCTTTGTGTATTTTCTTTTGG - Intronic
1176771162 21:13075403-13075425 TAGCTCTGCATATTTTGTATGGG + Intergenic
1177022590 21:15881818-15881840 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1177764188 21:25438170-25438192 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1178476170 21:32939228-32939250 CAGCTCTGTGTATATGGGAGGGG - Intergenic
1180724419 22:17935127-17935149 CAGCTTTGTTTTTTTTGCTTAGG - Intronic
1181941685 22:26483108-26483130 CAGCTCTAGATATTTTGGATTGG + Intronic
1182742165 22:32575792-32575814 CAGCTTTGTTTATTTGGCATGGG + Intronic
1182933268 22:34195084-34195106 GTGCTCTGTGTATTCTGCAGTGG + Intergenic
1183117987 22:35706522-35706544 CAGCTCTGTGGATTTCTCCTGGG + Intergenic
1184464671 22:44661703-44661725 CAGCTCTGTGTATACAGCACAGG - Intergenic
949297958 3:2548617-2548639 CAGCTTTGTTCATTTTGCTTAGG + Intronic
950498517 3:13349059-13349081 CGGCTGTGTGTATGTTTCATGGG - Intronic
950536481 3:13581905-13581927 CATCTCTGTGTTTTCTGCTTGGG + Intronic
951010773 3:17676700-17676722 CAGCTTTGTGCTTTTTGCTTAGG - Intronic
951307968 3:21088974-21088996 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
952127831 3:30322803-30322825 CAGCTTTGTTCATTTTGCTTGGG - Intergenic
952548154 3:34445418-34445440 CAGCTTTGTCCTTTTTGCATAGG + Intergenic
953113630 3:39968765-39968787 CAGCTTTGTTCATTTTGCTTAGG + Intronic
953806385 3:46072819-46072841 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
954125561 3:48525896-48525918 CATCTCTGTGTGTATTGGATGGG - Intronic
954781824 3:53067582-53067604 CAGCTCAATGAATTTTACATAGG - Intronic
956455823 3:69419782-69419804 CTTCTCTGTGTATGCTGCATAGG - Intronic
956837583 3:73108012-73108034 CAGCTCTCTGTACTGTGCTTTGG + Intergenic
956839544 3:73124976-73124998 CGGCTCTGCTGATTTTGCATGGG + Intergenic
956968401 3:74491140-74491162 CAAATATGAGTATTTTGCATTGG - Intronic
957522976 3:81344768-81344790 CATCTTTGTGTATTTTCCTTTGG - Intergenic
958156010 3:89756735-89756757 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
958447790 3:94236463-94236485 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
958463034 3:94422982-94423004 CAGCTTTGTTGATTTTGCTTAGG - Intergenic
958660367 3:97059270-97059292 CAGCTGGTTTTATTTTGCATAGG - Intronic
959205416 3:103300628-103300650 CAGCTTTGTTTGTTTTGCTTAGG + Intergenic
959271911 3:104222182-104222204 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
960346825 3:116543304-116543326 CAGCTTTGTTCATTTTGCTTAGG - Intronic
960368011 3:116797371-116797393 CCGCTCTGTGTAGTTTACCTTGG + Intronic
961491624 3:127260467-127260489 CCGCTTTGTGGATTTAGCATGGG - Intergenic
962799725 3:138879890-138879912 CAGCAGTGTGGATTTTGCCTTGG + Intergenic
962921045 3:139950902-139950924 CAGATCTGTGTGTGTTGTATTGG + Intronic
963338274 3:144002394-144002416 CAGTTCTGTGGGTTTTGCCTGGG - Intronic
963484840 3:145922588-145922610 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
964151110 3:153525435-153525457 CACCTCTGTGTATTTTCAAATGG + Intergenic
964792229 3:160463156-160463178 CAGCTATGTCTACTCTGCATTGG + Intronic
965097083 3:164244159-164244181 CAGTTCTGTGTATTTTCTGTGGG - Intergenic
965253746 3:166377333-166377355 CAGCTTTGTTCTTTTTGCATGGG + Intergenic
965887855 3:173470734-173470756 CAGCTCAGTATATTTTGATTAGG + Intronic
967619382 3:191614569-191614591 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
967630010 3:191734769-191734791 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
968790518 4:2658132-2658154 CAGCTCTGGGTATTTTGCAAAGG + Intronic
969486365 4:7474561-7474583 CAGCTCTGTGAATTCTGCATGGG + Intronic
970685656 4:18564074-18564096 CAGCTTTGTGCTTTTTGCTTAGG - Intergenic
970749348 4:19338735-19338757 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
970810022 4:20081456-20081478 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
971567477 4:28163741-28163763 CAGTTCTGTACATTTTGCTTAGG + Intergenic
971723282 4:30274553-30274575 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
972901716 4:43693149-43693171 CAGCTTTGTTTATTTTGCTTAGG + Intergenic
973010019 4:45061286-45061308 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
973732643 4:53838041-53838063 CAGCTTTGTGGTTTTTGCTTAGG - Intronic
974188279 4:58468114-58468136 CAGTTCTGTATATTTTGTAATGG + Intergenic
974797479 4:66771483-66771505 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
975664366 4:76720438-76720460 CAGCTCAGTGTTTTTTGACTTGG + Intronic
975984215 4:80188230-80188252 CAGCTCAGTGTCTTCTGCTTTGG - Intronic
976115274 4:81719895-81719917 CAGCTCTGTTCTTTTTGCTTAGG - Intronic
976716437 4:88127471-88127493 CAGCTTTGTTCTTTTTGCATAGG - Intronic
977060350 4:92251477-92251499 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
977428411 4:96900100-96900122 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
977538203 4:98281052-98281074 CAGCTTTGTTCTTTTTGCATAGG + Intronic
977600902 4:98932504-98932526 CAGCTCTATATATTTAGGATTGG - Intergenic
978073357 4:104498030-104498052 TACTTCTGTGGATTTTGCATTGG - Intergenic
978600982 4:110427632-110427654 CAGCTTTGTTTTTTTTGCTTAGG + Intronic
978685943 4:111443616-111443638 CAGCTTTGTACATTTTGCTTAGG + Intergenic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
979527035 4:121728293-121728315 CTGCTCTCTGTTTGTTGCATTGG - Intergenic
980504021 4:133691433-133691455 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
981043527 4:140245113-140245135 CAGCTCTGTGTAATGTCCTTGGG - Intergenic
981388566 4:144160225-144160247 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
981448286 4:144866219-144866241 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
981514516 4:145592763-145592785 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
981794502 4:148580936-148580958 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
984202183 4:176738250-176738272 CAGCTTTGTGCTTTTTGCTTAGG - Intronic
984301023 4:177917800-177917822 CAGCTTTGTGCTTTTTGCTTAGG + Intronic
985214274 4:187633721-187633743 CAGGTGTGTGTTTTTTGCCTTGG - Intergenic
986542848 5:8865261-8865283 CACCTCTGTGTATCTTTAATAGG + Intergenic
987019726 5:13857561-13857583 CAGCTCTGTTCTTTTTGCTTAGG - Intronic
987035996 5:14018800-14018822 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
987395333 5:17417681-17417703 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
987499850 5:18695711-18695733 AAGATCTTTGTTTTTTGCATTGG + Intergenic
988186227 5:27866575-27866597 CAGCTTTGTTCCTTTTGCATAGG - Intergenic
988368410 5:30333461-30333483 CAGCTTTGTTTATTTTGCTCAGG - Intergenic
988950802 5:36258274-36258296 CAGTTCTCTGTGTTTTGCAGAGG - Intronic
989956211 5:50363583-50363605 CAGCTCTCTGAATTTTGGAAAGG - Intergenic
990230510 5:53708164-53708186 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
990619560 5:57545099-57545121 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
990627626 5:57632373-57632395 TAGCTCTCTGTATGTGGCATAGG + Intergenic
992099419 5:73392280-73392302 TCTCTCTGTGTATTTTGCATAGG + Intergenic
992280711 5:75173927-75173949 CAGCTTTGTTTTTTTTGCTTAGG - Intronic
993244694 5:85436132-85436154 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
993734780 5:91463676-91463698 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
994598100 5:101864955-101864977 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
994850615 5:105050672-105050694 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
995357266 5:111253283-111253305 CAGCTCTGAGTCTTCTCCATGGG - Intronic
996193882 5:120579681-120579703 CAGCTCTGTTATTTTTGCTTAGG + Intronic
996271208 5:121606846-121606868 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
996639483 5:125734982-125735004 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
997070116 5:130611703-130611725 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
997300980 5:132804916-132804938 CAGCTTTGTTTGTTTTGCTTAGG - Intronic
997951729 5:138247748-138247770 CAGCTCTGGGTCTATTGTATAGG - Intergenic
998390589 5:141784765-141784787 CAGCTCTGTGCATTTTAAAGAGG + Intergenic
998910661 5:146956583-146956605 CTGGTCTGTGTGTTTGGCATGGG - Intronic
999208839 5:149870121-149870143 CTAATCTGTGTATTTTTCATAGG - Intronic
999630400 5:153564843-153564865 CAGATCTGTGTATTTTGTATGGG + Intronic
1000550115 5:162651386-162651408 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1000798655 5:165696394-165696416 CAGCTTTGTTTATTTTGCTTAGG - Intergenic
1001357967 5:171049911-171049933 CAGCTTTGTTTCTTTTGCTTAGG + Intronic
1001469882 5:172004961-172004983 CAGTTCTGTGAATTATGCAAAGG + Intronic
1002597712 5:180335005-180335027 CAGGTCTGTGTCACTTGCATGGG - Intronic
1002686391 5:181014345-181014367 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1004319344 6:14620655-14620677 GAGCTCTGTGCATTGTGCAGAGG + Intergenic
1004593690 6:17078449-17078471 CAGCTTTGTTTCTTTTGCTTAGG - Intergenic
1004828225 6:19447413-19447435 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1007847283 6:44769978-44770000 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1008179733 6:48313570-48313592 CAGCTCTGTATTTTTTCCATAGG - Intergenic
1010496045 6:76534567-76534589 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1010638237 6:78286737-78286759 CAGCTTTGTCTTTTTTGCTTAGG + Intergenic
1010667878 6:78651416-78651438 CAGCTCTGTTTTTTTGGCTTAGG - Intergenic
1011932380 6:92730358-92730380 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1012295304 6:97514284-97514306 CAGCTCTGTGGCTCTTGCAGGGG + Intergenic
1013038416 6:106409572-106409594 CAGCTTTGTTTGTTTTGCTTAGG - Intergenic
1014133433 6:117861325-117861347 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1014347639 6:120294160-120294182 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1014567119 6:122963045-122963067 TAGCTCTGTTCATTTTGCTTAGG - Intergenic
1015000114 6:128203973-128203995 CAGCTTTGTTCATTTTGCTTTGG - Intronic
1015205962 6:130639004-130639026 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1016102480 6:140119439-140119461 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1016663372 6:146606843-146606865 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1016789971 6:148057990-148058012 CAGCTTTGTGCTTTTTGCTTAGG + Intergenic
1017781058 6:157715730-157715752 CTCCTCTGTGTATTTGCCATGGG + Intronic
1019071466 6:169349320-169349342 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1019086651 6:169484721-169484743 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1019974355 7:4568807-4568829 CAGCTCTTTTTATTTTGGTTTGG + Intergenic
1020575743 7:9924860-9924882 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1020614924 7:10447304-10447326 CAGCTTTGTTTCTTTTGCTTAGG - Intergenic
1022336325 7:29425260-29425282 CAGCTCTGGGCATCTTGCACAGG - Intronic
1022844487 7:34196371-34196393 CATCTTTGTGTATTTTTCTTCGG - Intergenic
1024254486 7:47530325-47530347 CATCTCTGTGTGCTTTGCGTTGG - Intronic
1024362398 7:48482136-48482158 TAGCTCTGTGAATTTTTCCTGGG - Intronic
1025238170 7:57248981-57249003 CTGCTCAGTGGAATTTGCATAGG - Intergenic
1026361075 7:69600636-69600658 TAGCTCTCTGTATTCTGTATGGG + Intronic
1027496784 7:78897573-78897595 CAGCTTTGTTCATTTTGCTTAGG + Intronic
1027628366 7:80572002-80572024 CAGCTTTGTTCATTTTGCTTAGG + Intronic
1028019782 7:85755811-85755833 CAGCTTTGTTTTTTTTGCTTAGG - Intergenic
1028327433 7:89544629-89544651 CAGCTCTGTTCTTTTTGCTTAGG - Intergenic
1028779112 7:94715553-94715575 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1028880106 7:95870632-95870654 CACCTATGTGGAGTTTGCATGGG - Intronic
1030421679 7:109314258-109314280 CAGCTTTATGTTTTCTGCATAGG - Intergenic
1031784358 7:126010191-126010213 CAGCTCTGTTGTTTTTGCTTAGG + Intergenic
1032361564 7:131260652-131260674 CAGCTTTGTTCTTTTTGCATAGG - Intronic
1033311013 7:140261869-140261891 CAGGTCTGTGTATTTTGTTAGGG + Intergenic
1033964066 7:146951736-146951758 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1034173875 7:149085231-149085253 CAGCTTTGTTCATTTTGCCTAGG + Intronic
1034526949 7:151670716-151670738 CAGCTCCGTGCATTATGCATAGG - Intronic
1035843371 8:2836390-2836412 CGGCTCTGTGTAGTGTGCAGGGG + Intergenic
1036418879 8:8577422-8577444 CACCTCTGTGTATTTCCCACTGG - Intergenic
1039678636 8:39702925-39702947 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1039679375 8:39712988-39713010 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1040923430 8:52650279-52650301 CAGGTGTGGGTATCTTGCATTGG - Intronic
1041213458 8:55576273-55576295 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1041524828 8:58793552-58793574 CAGGTTTGTTTTTTTTGCATAGG - Intergenic
1041749808 8:61248227-61248249 CAGCTTTGTTCTTTTTGCATAGG + Intronic
1043281174 8:78468605-78468627 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1043318441 8:78950594-78950616 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1043318602 8:78952486-78952508 CAGCTTTGTTCATTTTGCTTGGG - Intergenic
1044054741 8:87554705-87554727 CAGCTCTGTTCATTTGGCTTAGG + Intronic
1045789886 8:105970886-105970908 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1045823505 8:106369839-106369861 CAGCTTTGTCCATTTTGCTTGGG + Intronic
1046992630 8:120476950-120476972 CAGCTCTGTTCTTTTTGCTTAGG - Intronic
1047575258 8:126146324-126146346 CAGCTTTGTTTCTTTTGCTTAGG + Intergenic
1047938592 8:129805877-129805899 CTTCTGTGTGTATTTTCCATAGG + Intergenic
1050368602 9:4897530-4897552 CAGCTTTGTGCTTTTTGCATAGG + Intergenic
1051205511 9:14684751-14684773 CAGCTTTGTTTTTTTTGCTTAGG - Intronic
1051545108 9:18264773-18264795 CATCTCTGTGTCTCTTGTATAGG + Intergenic
1051782089 9:20700179-20700201 CACCTCTGTGTATTTCCCATTGG - Intronic
1052551400 9:29954745-29954767 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1053082159 9:35185361-35185383 CAGCTCTGTGTAGCTTCCTTTGG + Intronic
1053859014 9:42367030-42367052 CAGCTTTGTGTTTTTTGCTCAGG - Intergenic
1055234485 9:74104053-74104075 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1056417847 9:86394668-86394690 CAGCTCTGTCCTTTTTGCTTAGG - Intergenic
1057306781 9:93916894-93916916 CAGCTCTTTGCATTTTGTAGGGG + Intergenic
1057345156 9:94243660-94243682 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1057464148 9:95296473-95296495 AAGCTCTGTGGATTTGGTATGGG - Intronic
1058354871 9:104072738-104072760 CATCTCTCTGTCTTTGGCATTGG - Intergenic
1058925712 9:109661606-109661628 CAGCTTTGTGCTTTTTGCTTAGG + Intronic
1059262291 9:112989563-112989585 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1059370876 9:113833582-113833604 CAGCTCTGGGCTTTTTGCAATGG - Intergenic
1062551288 9:137087844-137087866 CAGCTCTATTTATTTTGAATGGG - Intronic
1186680858 X:11872079-11872101 AGGCTCTGTGCATTTTTCATTGG - Intergenic
1187108570 X:16271049-16271071 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1187801901 X:23073144-23073166 CAGCTTTGTTCTTTTTGCATAGG - Intergenic
1187860195 X:23674542-23674564 CATCTATGTGTATTTTGGAGAGG - Intronic
1188084871 X:25891836-25891858 CTTTTCTGTATATTTTGCATAGG - Intergenic
1188230002 X:27650237-27650259 CAGCTCTGTTCATTTTCCTTAGG + Intronic
1188725114 X:33573322-33573344 CAGCTTTGTGCTTTTTGCTTAGG + Intergenic
1188771050 X:34154983-34155005 CAGCTTTGTTTCTTTTGCTTAGG + Intergenic
1189103099 X:38211327-38211349 CGCCTCTGTGTATTTTGATTTGG - Intronic
1189575904 X:42353296-42353318 CTGGTCTGTTTACTTTGCATAGG + Intergenic
1189604898 X:42666553-42666575 CAGTTCTATGAATTCTGCATTGG + Intergenic
1190901554 X:54679107-54679129 CAGCTTTGTTAATTTTGCTTAGG + Intergenic
1190992704 X:55568239-55568261 CAGCTCAGTGTGTTTTGAAGTGG - Intergenic
1191147371 X:57181777-57181799 CAGCTTTGTGCTTTTTGCTTAGG - Intergenic
1191168150 X:57413655-57413677 CAGCTTTGTTCATTTTGCTTAGG + Intronic
1192506288 X:71685701-71685723 CATATCTTTGTATTTGGCATTGG + Intergenic
1192520409 X:71795847-71795869 CATATCTTTGTATTTGGCATTGG - Intergenic
1192980735 X:76337758-76337780 TAGCTTTGTGTGTTTTGCTTAGG - Intergenic
1193030654 X:76894786-76894808 CAGCTTTGTGCTTTTTGCTTAGG - Intergenic
1193452928 X:81692906-81692928 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1193581188 X:83265098-83265120 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1193976224 X:88122475-88122497 CAGCTTTGTTTATTTTGCTTAGG - Intergenic
1194034899 X:88858287-88858309 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1194217132 X:91144527-91144549 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1194585259 X:95725201-95725223 CAGTTCTGAGTGCTTTGCATGGG + Intergenic
1195396688 X:104418553-104418575 CAGATTTGTTCATTTTGCATAGG - Intergenic
1195399319 X:104445019-104445041 CAGCTATGTGTTGTTTGTATGGG + Intergenic
1195906710 X:109851483-109851505 CTGCTGTGTGTATTTTTCTTGGG + Intergenic
1196531296 X:116789906-116789928 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1196602466 X:117618143-117618165 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1196949464 X:120862306-120862328 CAGCTCTGTTCTTTTTGCTTAGG + Intergenic
1197377632 X:125701175-125701197 CAGCTTTGTTTCTTTTGCTTAGG + Intergenic
1197395032 X:125917042-125917064 CAGCTTTGTTTCTTTTGCTTAGG + Intergenic
1197516192 X:127432699-127432721 CAGCTTTGTTCATTTTGCTTAGG + Intergenic
1198148254 X:133880893-133880915 CAGCTCTGTATATCTTTAATTGG + Intronic
1198733130 X:139755533-139755555 CAGCTTTGTTCATTTTGCTTAGG - Intronic
1198785778 X:140286166-140286188 CAGCTTTGTGCTTTTTGCTTAGG + Intergenic
1199361553 X:146925692-146925714 CAGCTCTGTTATTTTTGCTTAGG - Intergenic
1200553649 Y:4608319-4608341 CAGCTTTGTTCTTTTTGCATAGG + Intergenic
1201537951 Y:15071452-15071474 CAGCTTTGTTCATTTTGCTTAGG - Intergenic
1201961568 Y:19686340-19686362 CAGCTTTGTTTTTTTTGCTTAGG + Intergenic
1202052970 Y:20799558-20799580 AAGCAATGTGTATTTGGCATTGG + Intergenic