ID: 1157103003

View in Genome Browser
Species Human (GRCh38)
Location 18:44746888-44746910
Sequence AGTGTGTAAGCACTGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157103003 Original CRISPR AGTGTGTAAGCACTGTCTTC AGG Intronic
905445403 1:38025501-38025523 TGTGTGTATGCACTCCCTTCTGG + Intergenic
908670668 1:66544105-66544127 AATCTGTAAGGCCTGTCTTCAGG - Intronic
912025074 1:105159819-105159841 ACTGTGCAAGCTCTGCCTTCAGG - Intergenic
917401490 1:174653951-174653973 AGTGTGTAAGAAATGTATTATGG + Intronic
921131552 1:212224234-212224256 AGTCTGTGAGCACTCTCTTGGGG - Intergenic
921366930 1:214383257-214383279 AGTGTGAAAGCACATGCTTCAGG - Intronic
921463237 1:215453945-215453967 AGTGTGCAAGCAGTGCCTTGTGG + Intergenic
1063931660 10:11034746-11034768 ATTGTGTAAGCAGTGGCATCTGG + Intronic
1064197144 10:13253468-13253490 AGTGAGAAGGCACTGTCTTGGGG + Intergenic
1067733462 10:48830713-48830735 AGAGAGTCTGCACTGTCTTCTGG - Exonic
1067805183 10:49387090-49387112 AGGGTAAAAGCACTGTCTTGTGG + Intronic
1067869731 10:49946969-49946991 ATTGTATAAGGTCTGTCTTCTGG - Intronic
1070834420 10:79438901-79438923 AGTGTGTAAGCACTGGGGACCGG + Intronic
1071509834 10:86254598-86254620 AGTGTGTGAACACTGACTCCAGG - Intronic
1075796472 10:125123631-125123653 AGTGCGTAAGCAGTGTCAACAGG - Intronic
1082786146 11:57318079-57318101 AGGGAATAAGCACTGTTTTCTGG - Intronic
1085510810 11:77087173-77087195 TGTGTGTAGGCACTGCCTACTGG + Intronic
1088955220 11:114610300-114610322 AGTGTGTAACCACTGTTATCCGG + Intergenic
1088956075 11:114615854-114615876 CGTGTGTAAGCACTGTGACCTGG + Intergenic
1091584749 12:1809839-1809861 AGTGGGGAAGCCATGTCTTCTGG + Intronic
1091597609 12:1889055-1889077 ACTGTTTATCCACTGTCTTCTGG - Intronic
1093108487 12:15118798-15118820 AGCGTGGAAGCATTGGCTTCTGG - Intronic
1095742574 12:45623174-45623196 AGTGTGTTATCATTGTCCTCAGG + Intergenic
1100806849 12:98294417-98294439 TGTGTTTAAGCCCTGTTTTCAGG - Intergenic
1100955824 12:99906994-99907016 TGTGTGTAAGCTCTGCCTTCAGG - Intronic
1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG + Intronic
1102209888 12:111118724-111118746 AGGGTCTAACCACTGTCTTAGGG - Intronic
1113197028 13:107819994-107820016 AGTCTGTAATCTTTGTCTTCAGG - Intronic
1115368788 14:32588671-32588693 AGACTGTAAGCACTGTCTGTAGG - Intronic
1116996504 14:51330373-51330395 AGTGTGTAGGCTTTGTCCTCAGG + Intergenic
1122610659 14:102980747-102980769 AGTGTGAAAGCACCGTTCTCAGG - Intronic
1202853089 14_GL000225v1_random:33601-33623 ATTTTGTAAGCACTGCCTACAGG - Intergenic
1123584050 15:21741533-21741555 ATTGTGTTAGCTCTGTCTCCTGG - Intergenic
1123620700 15:22184136-22184158 ATTGTGTTAGCTCTGTCTCCTGG - Intergenic
1125097642 15:35872936-35872958 AATAGGTAATCACTGTCTTCTGG - Intergenic
1127181114 15:56419095-56419117 AGTGTGTAAAACCTGTATTCTGG - Intronic
1130960671 15:88656876-88656898 AGTGTGACAGCACCGTGTTCAGG - Intergenic
1132308387 15:100835655-100835677 AGTGTGTAAGCATTCTTTTTGGG + Intergenic
1135200376 16:20432004-20432026 ATTGTGTCAGAGCTGTCTTCAGG + Intronic
1135218309 16:20591565-20591587 ATTGTGTCAGAGCTGTCTTCAGG - Intergenic
1135568775 16:23532230-23532252 AGTGAGTGAGCACTGTCTCATGG - Intronic
1137621437 16:49879107-49879129 AGTCAGTAATCAGTGTCTTCTGG - Intergenic
1140464256 16:75166892-75166914 AGTGGGTAAGGACGGTTTTCAGG + Exonic
1141829331 16:86500922-86500944 AGTGTGCAAGCACTGTGCTGAGG - Intergenic
1141940357 16:87271928-87271950 ATCGTGTCACCACTGTCTTCTGG - Intronic
1147998318 17:44373717-44373739 AGGGTGTAAGTCCTGCCTTCAGG - Intronic
1151166652 17:72209569-72209591 AGTGTGTAATCACTGGGTTCTGG - Intergenic
1152922335 17:83072411-83072433 AGTCTTTAAGCACTGTCTGGGGG - Intergenic
1153713991 18:7827126-7827148 ATTGTGTATGGACTGTGTTCAGG + Intronic
1153889982 18:9503895-9503917 ATTTTGTAAGCACTGTTTGCAGG - Intronic
1155337701 18:24782162-24782184 ATGGTGGAAGCACTGTTTTCTGG + Intergenic
1157103003 18:44746888-44746910 AGTGTGTAAGCACTGTCTTCAGG + Intronic
1161651035 19:5485092-5485114 AGTGTCTCTGCTCTGTCTTCAGG - Intergenic
1162671252 19:12259662-12259684 AGGGTGTCATCACTGTCATCAGG + Intronic
1164317027 19:24099465-24099487 AGTGCGCTAGCACAGTCTTCAGG + Intronic
1164828517 19:31302034-31302056 TGAGTGTAAGGAATGTCTTCAGG - Intronic
1165710787 19:38009371-38009393 AGTGTGGAGGCACTCTCCTCTGG + Intronic
1165828463 19:38718930-38718952 AGTGGGTGAGCACTGTCTGAGGG - Intronic
926599786 2:14830094-14830116 AGTGTGTCAGCTTTGCCTTCAGG + Intergenic
931688998 2:64819361-64819383 AGAGTGCAAGAACTTTCTTCAGG - Intergenic
932420802 2:71600144-71600166 AGTGTGACAGATCTGTCTTCTGG + Intronic
932709435 2:74051111-74051133 AGTGCATAAGCACAGTCTTGGGG + Intronic
937126791 2:119479934-119479956 ATTGTCTAAGCACAGCCTTCTGG + Intronic
938650757 2:133381113-133381135 AATGTGTAAGCACTATCTGATGG - Intronic
944368208 2:198949372-198949394 AATGTGGAAGCAGTGCCTTCTGG - Intergenic
947154848 2:227152159-227152181 AGGGTGTAAGAACTGTCTGGGGG - Intronic
948485923 2:238280987-238281009 AAAGTGTAAACATTGTCTTCTGG - Intronic
948543290 2:238704957-238704979 AGCATGTTAGCACTGTCTCCTGG + Intergenic
1175457313 20:59125154-59125176 AGTGTGCAAGCTCTGTCCCCAGG - Intergenic
1182069000 22:27450249-27450271 AGGGTGTGAGTACTGTCTTTGGG - Intergenic
1184425659 22:44407781-44407803 AGAGGGTAAGCTCTGTCTTGTGG - Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
950054223 3:10012027-10012049 ATGGTGTCAGCAGTGTCTTCTGG - Intergenic
950270412 3:11610234-11610256 AGTGAGTAAGCCCTGGCTGCCGG - Intronic
950305406 3:11912463-11912485 ATGGTGTCAGCAGTGTCTTCTGG - Intergenic
953079520 3:39602817-39602839 TGTTGGGAAGCACTGTCTTCAGG - Intergenic
955271163 3:57500746-57500768 AAGGCATAAGCACTGTCTTCAGG - Intronic
958951599 3:100423102-100423124 AGTATTTAAGCACTGCTTTCTGG + Intronic
960166343 3:114406344-114406366 AGTGTGTTTGAACTGGCTTCAGG + Intronic
963055342 3:141181935-141181957 AGTGTAGAAGGGCTGTCTTCTGG + Intergenic
963473421 3:145773417-145773439 AGTCTCTCAGCACTGTGTTCAGG - Intergenic
967753390 3:193140727-193140749 TTTGTTTAAGCACTGTTTTCTGG + Intergenic
970369359 4:15392239-15392261 AATGTGCAAGCCCAGTCTTCTGG - Intronic
975122507 4:70744522-70744544 AGAGTGTTAACACTGGCTTCTGG + Intronic
977639739 4:99343410-99343432 AGATTGTAATCACTGTCATCTGG - Intronic
977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG + Intergenic
980820811 4:138014185-138014207 AATGTGACTGCACTGTCTTCAGG + Intergenic
981180224 4:141733279-141733301 AGTGTGGAACCACTGACTACTGG + Exonic
982317889 4:154049614-154049636 TGTGTGAAATCACTGTCTTCAGG - Intergenic
984231754 4:177108906-177108928 AGTGTGTTAGCACCATCTCCTGG - Intergenic
987911897 5:24157735-24157757 AGTATGTATGCACTCTATTCTGG + Intronic
989510549 5:42282001-42282023 AATGTTTAAGCACTGTTTTGAGG + Intergenic
989962970 5:50438131-50438153 TGTGTTTAAGCACTGTGTTTAGG + Intronic
989963600 5:50443452-50443474 TGTGTTTAAGCACTGTGTTTAGG - Intergenic
990044724 5:51415310-51415332 AATGGGCAAGCACTGTGTTCTGG + Intergenic
991977745 5:72199631-72199653 AGGGTGAAAGCTCTGTCTTGGGG - Exonic
992662790 5:78977988-78978010 AGTGTGTAAGCATTGTGCTTTGG - Intronic
994090024 5:95801730-95801752 ACTGAGTAACCACTGTCCTCAGG + Intronic
994634187 5:102323292-102323314 CATGTGAAAGCAATGTCTTCGGG - Intergenic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
997441283 5:133910278-133910300 AATGTGTAAGCACTGTCATTTGG + Intergenic
998733026 5:145102756-145102778 AGTTTGTAAGAACTATCTACTGG + Intergenic
999396515 5:151232643-151232665 GATGGGTAAGCACTGTTTTCTGG + Intronic
1001929398 5:175662096-175662118 GGTGTGTAAGCAGGGTCCTCAGG + Intronic
1002983349 6:2163924-2163946 ATTGTGAAAGCCATGTCTTCTGG + Intronic
1003011267 6:2429481-2429503 GGAGTGTAAGCATTCTCTTCTGG + Intergenic
1004008213 6:11656350-11656372 AGCGTGCCAGCACTTTCTTCTGG - Intergenic
1015688914 6:135898268-135898290 AGTGTGTAATAAATTTCTTCTGG - Intronic
1016277343 6:142370256-142370278 AGTGTGAAAGCACTGAGCTCTGG - Exonic
1024118639 7:46215833-46215855 CGTGTGTAAGAACAGCCTTCGGG + Intergenic
1025144871 7:56494102-56494124 ACAGTGTGAGCACTGCCTTCGGG + Intergenic
1025189285 7:56884329-56884351 AGTGTGTATGGACAGACTTCAGG - Intergenic
1025682655 7:63692588-63692610 AGTGTGTATGGACAGACTTCAGG + Intergenic
1026309970 7:69174961-69174983 ACTTTGTGAGCTCTGTCTTCAGG + Intergenic
1030021456 7:105279135-105279157 AGTCTGTGGGCACTGTGTTCAGG - Intronic
1034230732 7:149526310-149526332 AGTTTTTAAGCACTTTCTTCTGG + Intergenic
1037562995 8:20091359-20091381 AGTCTGTAAGTAGTGTCTCCAGG + Intergenic
1039590153 8:38739434-38739456 TGTATGTAAGCACTGACATCTGG - Intronic
1040762217 8:50862841-50862863 AGTGTGTAAAAACTTTATTCTGG - Intergenic
1040917447 8:52577735-52577757 AAAGTGTATGCCCTGTCTTCAGG - Intergenic
1044108882 8:88247191-88247213 ATTATATAAACACTGTCTTCTGG - Intronic
1046427669 8:114076595-114076617 AGTGAGTAAGCAATAACTTCAGG + Intergenic
1048612794 8:136041997-136042019 TTTGTGTAAGCACCGTCTGCAGG + Intergenic
1054724235 9:68634335-68634357 AGTGTGTGCACAGTGTCTTCAGG - Intergenic
1056545233 9:87607303-87607325 ACTTTGTATGCACTGTCTTAAGG - Intronic
1061490542 9:130941592-130941614 TGTGGGTCAGCACTGGCTTCTGG - Intergenic
1061821090 9:133227581-133227603 AGTCTGTAAGCCCTGCCTGCTGG + Intergenic
1189565997 X:42241687-42241709 AGTACTTAAGCACTCTCTTCAGG - Intergenic
1191268651 X:58432344-58432366 AGTTTGGAAGCACTGTTTTTTGG - Intergenic
1192182074 X:68922393-68922415 AGTGGATAGCCACTGTCTTCAGG + Intergenic
1192918352 X:75678840-75678862 AGTGTTTATGTACTGTCTTTTGG + Intergenic
1195750179 X:108156573-108156595 AGTGTGGAAACACTGGGTTCTGG + Exonic