ID: 1157104631

View in Genome Browser
Species Human (GRCh38)
Location 18:44762172-44762194
Sequence CAGAACTGGGAAAAGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157104631_1157104638 28 Left 1157104631 18:44762172-44762194 CCTGACTTCTTTTCCCAGTTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1157104638 18:44762223-44762245 GCAAATTCTTCCAGTTCTTTAGG 0: 1
1: 0
2: 3
3: 33
4: 344
1157104631_1157104635 -8 Left 1157104631 18:44762172-44762194 CCTGACTTCTTTTCCCAGTTCTG 0: 1
1: 0
2: 1
3: 37
4: 460
Right 1157104635 18:44762187-44762209 CAGTTCTGGAGTGCTCTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157104631 Original CRISPR CAGAACTGGGAAAAGAAGTC AGG (reversed) Intronic
900858630 1:5206959-5206981 TAGAACTGTGAAGACAAGTCAGG + Intergenic
902118120 1:14138622-14138644 CAGAAGTGGGAGAAGATATCAGG + Intergenic
902397615 1:16141026-16141048 CAGAAGTGGGAAAGGAGGCCCGG - Intronic
902957695 1:19937145-19937167 CAGAACTGGGACTTGAACTCAGG - Intergenic
903121926 1:21221814-21221836 CAGAACTGGGTGAAGAAGAACGG - Exonic
903472873 1:23599460-23599482 CAGAGCTGGGAAATGAACCCAGG - Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
904699319 1:32348993-32349015 CAGAACTGGGACCAGAATCCAGG - Intergenic
905307339 1:37028743-37028765 TAGAAGTGGGATAAGAAGTATGG - Intronic
905732450 1:40306097-40306119 CAGAATTGAGCAAGGAAGTCTGG - Intronic
906459113 1:46023754-46023776 CAGCCCTGGGAAACAAAGTCCGG - Exonic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906707596 1:47906093-47906115 CAGAGCTGGGATCAGAAGCCAGG + Intronic
907654783 1:56331447-56331469 CTGAACTTGGAAGAGAGGTCAGG + Intergenic
907811609 1:57876497-57876519 CAGAACTGGGAAAATGATTCAGG + Intronic
907828827 1:58044670-58044692 CAGAACTGGGATCTGAAGTCTGG - Intronic
907943144 1:59108007-59108029 CGGCATAGGGAAAAGAAGTCAGG - Intergenic
908358400 1:63344444-63344466 CAGGGCTGGGCCAAGAAGTCAGG - Intergenic
908666465 1:66496672-66496694 CAGAACTGGAGAAGGAAGACAGG + Intergenic
909505818 1:76388604-76388626 CAGCAGTGGGAAAGGGAGTCTGG - Intronic
909753397 1:79192533-79192555 CAGTACTGTGAAAAGGACTCAGG + Intergenic
911096808 1:94061720-94061742 CAGAGCTGGGAAATGGAGCCAGG - Intronic
911502533 1:98706135-98706157 CAGCACTGGGGAAAGAAACCAGG + Intronic
915595481 1:156894165-156894187 CAGGGCTGGGAAGAGAAGACTGG + Intronic
916066663 1:161141480-161141502 CAGAACTGATAGAAAAAGTCAGG + Intergenic
916247776 1:162705723-162705745 CAGATCTGGGACTAGAACTCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917197654 1:172483359-172483381 CAATACTGGGAAAGGAAGACAGG + Intergenic
917289016 1:173453066-173453088 CAAATATAGGAAAAGAAGTCAGG + Intergenic
918377709 1:183925746-183925768 CAGAACTGGGATTTGAACTCGGG - Intronic
918946595 1:191074349-191074371 CAGAACTAGGAATAAAAGTCAGG - Intergenic
919424156 1:197408247-197408269 CAGAACTGTGAAAGAAAGTTGGG + Intronic
919565129 1:199174805-199174827 AAGAAATAGGAAAAGAAGTAAGG - Intergenic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
924666489 1:246078456-246078478 CAGAAGTGGAACAAGAAGGCCGG - Intronic
1063506830 10:6607211-6607233 CAGAACTGGGACAAGAATCTAGG + Intergenic
1063570654 10:7211817-7211839 CGTAACTGGCAAAAAAAGTCAGG - Intronic
1063718987 10:8559423-8559445 CAGAATTGGGACCAGAATTCAGG + Intergenic
1064460775 10:15532960-15532982 CAGAGCTGGGAAGAGATGCCAGG - Intronic
1064614886 10:17142666-17142688 CAGAAGAGGGAACTGAAGTCTGG - Intronic
1064632350 10:17329309-17329331 CAGAACTGGGATAGGAACCCAGG + Intronic
1065078223 10:22102130-22102152 CATAACTGGGAAAACAAGAAGGG - Intergenic
1065175635 10:23072412-23072434 CAAAACTGAGAAAAGAAGGTCGG + Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065556600 10:26921678-26921700 TAGTACTGGGAAAAGAATTATGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1067956454 10:50796277-50796299 CAGAACTGGGGCCAGAATTCTGG + Intronic
1068211131 10:53922467-53922489 CAGAACTGGGTATGGAATTCAGG + Intronic
1069923870 10:71834560-71834582 CAGCCCTGGGGAAATAAGTCAGG - Intronic
1069967042 10:72128324-72128346 CAGAACTGAGACTAGAAGCCAGG - Intronic
1071749273 10:88456529-88456551 CAGAGCTGAGAATAGAATTCAGG + Intronic
1071932952 10:90494651-90494673 CACATCTGGGAAAGGAATTCTGG - Intergenic
1071955213 10:90750261-90750283 AAGAACTGGAGAGAGAAGTCAGG - Intronic
1072032899 10:91538318-91538340 CAGAGCTGGGAACAGGACTCTGG + Intergenic
1072420317 10:95285498-95285520 CAGAGCTGGGAAGTGAAGCCAGG - Intronic
1072459221 10:95604317-95604339 CAGAGCTGGAAAAAAAATTCTGG + Intergenic
1074048871 10:109864883-109864905 CATCACTGGCCAAAGAAGTCGGG + Exonic
1074102657 10:110365669-110365691 CAGAACTGGGATCTGAATTCTGG - Intergenic
1074126944 10:110536132-110536154 CAGAACTGGGCAGTGAAATCAGG - Intergenic
1075479283 10:122766084-122766106 CTGAACTGGGATATGAAGCCAGG - Intergenic
1075534868 10:123262476-123262498 CAGAATTGGGACTAGAACTCAGG - Intergenic
1076044822 10:127283282-127283304 CAGAAATGGGAAAGGAGGCCTGG + Intronic
1076986312 11:238411-238433 CAGAGCCAGGAAAAGAACTCAGG + Intronic
1077498009 11:2896062-2896084 CAGAACTGGGAAACTCAGGCAGG - Intronic
1077774727 11:5258465-5258487 AGGAACTGGGAAAAGATGACAGG + Intronic
1078725789 11:13929781-13929803 CAGGGCTGGGAAAAGCATTCAGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1080267419 11:30416182-30416204 CTGAAGTGTTAAAAGAAGTCAGG + Intronic
1080930451 11:36804796-36804818 CAGTACTGAGAAGAGAAATCTGG + Intergenic
1081010653 11:37807365-37807387 CAGAACTGGGACAAAAACTTGGG - Intergenic
1081718532 11:45268652-45268674 CAGAACTGGGAATTGAACCCAGG + Intronic
1083057206 11:59834170-59834192 AAGTACTAGGAAAAGAGGTCAGG - Intronic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1084904789 11:72337176-72337198 AAGAACTGGGAATAGAGCTCTGG + Intronic
1084970098 11:72766738-72766760 CTGAGATGGGAAAGGAAGTCAGG + Intronic
1085518454 11:77124655-77124677 CAGCACTGGGCAGAGGAGTCAGG - Exonic
1085550562 11:77366766-77366788 CAGCACTGTGGAAAAAAGTCTGG + Intronic
1085719061 11:78897291-78897313 CAGCAAAGGGAAAAGAAGCCTGG - Intronic
1085720754 11:78910521-78910543 CAGAACTGAGACTGGAAGTCAGG - Intronic
1087502162 11:98971447-98971469 CAGGAATGGAAAAATAAGTCTGG + Intergenic
1087646438 11:100813510-100813532 CAGAGCTGGAAAAAGAAATTTGG + Intronic
1088162505 11:106889418-106889440 CAGATCTGAGATAGGAAGTCAGG - Intronic
1088549109 11:110992343-110992365 CAGAGCTGGGAGAAGAACCCAGG - Intergenic
1088835009 11:113570280-113570302 CAGAACTGGGATTAGCACTCAGG - Intergenic
1090651653 11:128811725-128811747 CAGAACTTGGAAAAGTTGTAGGG + Exonic
1091216917 11:133907759-133907781 TAGAACTGGGCAAAGAGGGCAGG + Intergenic
1091960991 12:4694190-4694212 CAAAACTGGGGAAGGAGGTCGGG - Exonic
1092079985 12:5707940-5707962 CAGAGCTCAGAAGAGAAGTCTGG - Intronic
1092297116 12:7209437-7209459 GAGGACTGGGAAAAGAAGGCTGG + Intronic
1092735622 12:11579775-11579797 CTGAACTGGGAGAAGAAGGGTGG - Intergenic
1093441202 12:19198379-19198401 CAAAAAGGGGAAAAGAAATCCGG - Intronic
1095243061 12:39883817-39883839 ACAAACTGGGAAAAGAGGTCAGG + Intronic
1096284226 12:50284090-50284112 CGGAACTGGGACAAGAATTTGGG - Intergenic
1098442588 12:70534284-70534306 AAGAAAGTGGAAAAGAAGTCAGG + Intronic
1098796378 12:74893550-74893572 CAGAGCTGGGAAAAGAATTTGGG + Intergenic
1100429701 12:94519767-94519789 CAGAACTGGGAAGAAAAGGATGG + Intergenic
1100710012 12:97245637-97245659 CAGAACTGGGAACAACTGTCTGG - Intergenic
1101418073 12:104526405-104526427 CTGAACTGGGGAAAAGAGTCAGG - Intronic
1102396950 12:112594328-112594350 CAGAATTGGGAATTGAAGCCAGG + Intronic
1102733627 12:115137475-115137497 CAGAACTGGGACAAGAATCAAGG + Intergenic
1102857737 12:116308877-116308899 CAGCAGAGGGAAAAGAAATCAGG - Intergenic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1106152033 13:27113739-27113761 CAAACCTGGGAAAAGAGCTCTGG - Intronic
1107496468 13:40930244-40930266 TAAAGATGGGAAAAGAAGTCCGG - Intergenic
1108552988 13:51565049-51565071 CCGAACTGGCAACAGAAGGCTGG - Intergenic
1111161011 13:84394615-84394637 CAGAATTGGGAAAAGACCGCAGG - Intergenic
1111292336 13:86185960-86185982 CTGAACTGGGGAAAGATGTAAGG + Intergenic
1112580168 13:100671667-100671689 CAGAACTGGGAAATGATGTAGGG - Intronic
1112597958 13:100826674-100826696 CAGAGCTGGGAAAGTAATTCAGG + Intergenic
1112636064 13:101219356-101219378 CAATACTGGGAAAAGGAATCCGG + Intronic
1113098161 13:106688401-106688423 GAGAAGTGGGGAAAGCAGTCAGG + Intergenic
1113240184 13:108328528-108328550 AAGAACTGGGAAAAGACCACAGG + Intergenic
1113763961 13:112869361-112869383 CAGAACTGGGATAAGGAGTTAGG - Intronic
1114408044 14:22474648-22474670 CAGAGCTGGGACTAGAACTCCGG - Intergenic
1114775101 14:25472938-25472960 CAAAACTGGGAAGAGAAGAAAGG - Intergenic
1115787829 14:36846390-36846412 CAAAACTGAAAAAAAAAGTCTGG - Intronic
1118243982 14:64090181-64090203 CAGAGCTGGGAACAGAATCCAGG - Intronic
1118602220 14:67478781-67478803 CAGAAGTGGGAAGACAACTCTGG - Intronic
1118760430 14:68877689-68877711 CAGAACTGGGATTTGAACTCAGG + Intronic
1118852050 14:69591674-69591696 CAGAGCTTGGAAAAGATATCTGG - Intergenic
1119104447 14:71910916-71910938 CAGAGCTGGGAAAAAAACTCAGG - Intergenic
1119861689 14:77940584-77940606 CTGAACTGGGGACAGAGGTCAGG + Intergenic
1119868095 14:77990862-77990884 CAGAGCTGGGTAAAGAAGCTGGG - Intergenic
1119949457 14:78729487-78729509 CAGGATTGAGAAAAGCAGTCAGG + Intronic
1120200760 14:81535654-81535676 CAAAACTGAAAAAAGAAGTTGGG - Intergenic
1120496147 14:85238787-85238809 CAGAAAAGGTAAAAGAAGTGTGG + Intergenic
1120557995 14:85954342-85954364 AAGGACTGGGAAAAGAGGGCCGG + Intergenic
1121434170 14:93907995-93908017 CAGAACTGGGACCTGAAGCCAGG + Intergenic
1121658661 14:95618055-95618077 CAGTTCTGGGAAAAGATGTAAGG + Intergenic
1122865190 14:104600703-104600725 CAGAAGTGTGAAAATTAGTCTGG - Intronic
1122903522 14:104791786-104791808 CAAGTCTGGAAAAAGAAGTCAGG + Intronic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1123911763 15:24975014-24975036 CAGTACAGAGAAAAGCAGTCTGG + Intronic
1123916557 15:25035421-25035443 GCTAACTGGGAAAAGAAGGCAGG - Intergenic
1123958441 15:25365969-25365991 CAGAATTGGAAATAGAAGTCAGG - Intronic
1124163289 15:27294509-27294531 CAAGACTGGGAAAAGAGGCCAGG - Intronic
1124384221 15:29193110-29193132 TAAAACAGGGAAAAGAAGTAAGG + Intronic
1124638428 15:31379844-31379866 CAGGACTTGGATTAGAAGTCAGG + Intronic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125292452 15:38164912-38164934 CTGAACTAGGAAGAGAATTCAGG + Intergenic
1125351314 15:38770388-38770410 CAGAACTGGGACAAGAATCCAGG - Intergenic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1126478762 15:49094590-49094612 CAGCACTGGGAAAGGAGGTAGGG - Intergenic
1128335629 15:66784102-66784124 CAGAACTGGGATTTGAACTCGGG - Intergenic
1128536846 15:68498085-68498107 CAGAGCTGGGAATTGAACTCTGG + Intergenic
1128690660 15:69722228-69722250 CAGAAGTGGCAAAAGAGGTCTGG - Intergenic
1129085854 15:73091040-73091062 CAGAACTGGGATTTGAACTCAGG + Intronic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1129683296 15:77670707-77670729 CAGAACTGGGCAGAGAAGCCAGG + Intronic
1129700468 15:77765117-77765139 CAGAACTGGGAAAGCAGGCCTGG + Intronic
1130200992 15:81826629-81826651 CAGAAATTGGAAAGGGAGTCAGG + Intergenic
1130678796 15:85978361-85978383 GAGAGGTGGGCAAAGAAGTCTGG - Intergenic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1131383103 15:91980821-91980843 CGGACCTGGGAAAAGTAGGCTGG - Intronic
1132802210 16:1759955-1759977 CAGGAATGGGCAAAGAAGTGGGG + Exonic
1134864304 16:17591019-17591041 CAGAAATGGGAAGTGAATTCAGG + Intergenic
1135460974 16:22642662-22642684 AAGAACTGGGAATAGACGTTCGG + Intergenic
1135466506 16:22690894-22690916 CAGAACTGGGATATGAACCCAGG + Intergenic
1136502222 16:30677655-30677677 CAGAGCAGGGAAATGAAGTGAGG - Intergenic
1137499946 16:49003245-49003267 CAGATGTGGGAAGAGAAGGCAGG - Intergenic
1137995673 16:53208552-53208574 CAGCACTGGGAAAGGAAGGAGGG - Intronic
1138377063 16:56571526-56571548 CAGAACTGGGAACTGAGCTCAGG + Intergenic
1138463596 16:57169982-57170004 CAGAACTGGGACTGGAAGCCAGG + Intronic
1138909037 16:61374367-61374389 CAGACCTGGGAAATGAATACAGG - Intergenic
1139255585 16:65538865-65538887 CCAAACTGGGGCAAGAAGTCAGG + Intergenic
1139711430 16:68779384-68779406 CAGAGCTGGGAATTGAACTCAGG - Intronic
1142480297 17:214840-214862 CAGGGCTGGGACAAGAACTCGGG + Intronic
1144131157 17:12249059-12249081 CAGCACAGGGAAAGGAACTCGGG + Intergenic
1145921418 17:28612987-28613009 CAGAACCAGGAAAAGAAGGTGGG + Intronic
1146605482 17:34254166-34254188 CACAACTGAGGAATGAAGTCAGG + Intergenic
1146642340 17:34550726-34550748 CAGAGCTGGGAACAGAATCCAGG + Intergenic
1146665680 17:34701457-34701479 CAGAGCTGGGACAAGAACTTAGG - Intergenic
1147313853 17:39609758-39609780 CAGAACTGGGCCTAGAATTCAGG + Intronic
1147574796 17:41593008-41593030 CAGCCCTGGGGAAAGAAGTGGGG + Intergenic
1147932508 17:43991453-43991475 CTCAACTGGGAAAAGAAATAAGG + Intronic
1148113831 17:45162919-45162941 CACATCTGGGACAAGAAGTTTGG - Intronic
1148440908 17:47711207-47711229 CAGAACAGGGAAAGGAGGACAGG - Exonic
1148449791 17:47769262-47769284 CAGAACTGGTACCAGAAGTTGGG + Intergenic
1148833465 17:50452040-50452062 CAGATCTGAGTAGAGAAGTCAGG - Intronic
1149009625 17:51841850-51841872 CAAAACTTGGAAAGGAAGACAGG - Intronic
1149374260 17:56028290-56028312 CAGAATTGGGAAACCAAGTTTGG + Intergenic
1150932724 17:69602803-69602825 CAGAGCTGGGATTAGAATTCAGG + Intergenic
1151339325 17:73459636-73459658 CAGAACTAGGATTTGAAGTCAGG - Intronic
1151518694 17:74613606-74613628 CAGAACTGGGACCCCAAGTCCGG + Intronic
1152463662 17:80454276-80454298 CAGAGGTGGGAGAAGAGGTCAGG + Intergenic
1152733897 17:81987386-81987408 CAGCGCGGGGAACAGAAGTCAGG + Intronic
1153396462 18:4627382-4627404 GGGAACTGGGACATGAAGTCTGG - Intergenic
1154295574 18:13144109-13144131 CAGAACTGTGAGAAAAAGGCAGG - Intergenic
1155382810 18:25243034-25243056 CAGACTTGGGAATAGAAGTTGGG - Intronic
1156527292 18:37778751-37778773 CAGGACTAGGAAAAGGCGTCGGG + Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1156940443 18:42760616-42760638 CAGAACTGGGACTAGAACCCAGG - Intronic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157231895 18:45925005-45925027 CAGAACTGGGATCAGAACCCAGG + Intronic
1157478912 18:48040329-48040351 CAGAGGTGTGGAAAGAAGTCCGG + Exonic
1157756717 18:50224702-50224724 TGGCACTGGGTAAAGAAGTCGGG + Intergenic
1159529129 18:69633061-69633083 CATAAATGAGAAAAGAAGTCAGG - Intronic
1159612969 18:70546837-70546859 AAGAACTGGGAAAAGACCACAGG - Intergenic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1159927381 18:74281445-74281467 GAGAAGTGGGAAAAGGAGACAGG + Intronic
1161406760 19:4095225-4095247 CAGCTCTGGGAAAAGGAATCTGG + Intronic
1161920716 19:7263526-7263548 CAGTACTGGAAAAACAAGCCCGG + Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162956635 19:14102482-14102504 CTGAACTGGGAAATGAACCCCGG + Intronic
1163532854 19:17860838-17860860 CAGAACTAGGACAAGACCTCAGG - Intronic
1164927845 19:32144165-32144187 AAGGCCTGGGAAAGGAAGTCTGG - Intergenic
1165689039 19:37848634-37848656 CAAAAATGGGAAAAGCAGGCCGG + Intergenic
1166009938 19:39934734-39934756 CTGAGGTGGGGAAAGAAGTCGGG + Intergenic
1166226883 19:41401517-41401539 CAGAGCAGGGGCAAGAAGTCGGG - Intronic
1166520989 19:43479903-43479925 CAGAACTGGGACACGAACCCAGG + Intronic
1166566194 19:43767051-43767073 CAGTACTGGGGAAAGTAGCCTGG + Exonic
1166887534 19:45971376-45971398 CAGGACTGGGAACAGCAGTGGGG + Intronic
1167200416 19:48061487-48061509 CAGAGCTGGGATATGAAGGCAGG + Intronic
1167691873 19:50990225-50990247 TGGAACTGGGAAAAGAATTGGGG - Intergenic
1168078401 19:53992600-53992622 AAGAACTTGGCAAAGAAGACGGG - Exonic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
925995785 2:9292017-9292039 CAGAGCTGGAACAAGAACTCGGG - Intronic
926404644 2:12538850-12538872 CAGAACTGGGAATAGAATTCAGG + Intergenic
926676898 2:15632502-15632524 TAGAACTGGAAATAGAACTCGGG + Intergenic
927087182 2:19684172-19684194 CAGAGCTGGGATTTGAAGTCAGG - Intergenic
927291401 2:21408379-21408401 CTGAACTGGGGAAAGAACCCTGG + Intergenic
927685005 2:25164467-25164489 AAGAAATGGGAGAAGAAATCAGG - Intronic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
929129669 2:38554701-38554723 CAGAGCTGGGATAAGCAGCCAGG + Intergenic
930000580 2:46859048-46859070 GAGAACTGGGAAATGAAGAAAGG + Intergenic
930357568 2:50341311-50341333 CTGAACTGGGACAGGAACTCAGG + Intronic
931145710 2:59514840-59514862 CAGAACTGGGATTAGAACTCAGG + Intergenic
932462416 2:71891495-71891517 CAGAGCTGGGGTCAGAAGTCAGG + Intergenic
932940696 2:76161283-76161305 TAGAACTCTGAAAAGAAATCTGG - Intergenic
933027561 2:77280117-77280139 CACATATGGGAACAGAAGTCAGG + Intronic
933494434 2:83030753-83030775 CAGAAATGGGGAAAGAAATGAGG + Intergenic
933950370 2:87323708-87323730 CAGAACCGAGAAGAGAAGCCCGG + Intergenic
934023213 2:87975897-87975919 AAGCACTGGCAAAAGAACTCTGG - Intergenic
936329408 2:111534865-111534887 CAGAACCGAGAAGAGAAGCCCGG - Intergenic
936491943 2:112979447-112979469 CCTAATTGGGAAGAGAAGTCAGG + Intronic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937467451 2:122147116-122147138 TAGAACAGAGAAAAGAGGTCTGG + Intergenic
937690177 2:124746690-124746712 CAGAACTGAGGACAGAGGTCAGG + Intronic
937776277 2:125780235-125780257 CAGCCGTGGGAAAGGAAGTCTGG - Intergenic
937791637 2:125968518-125968540 CAGAAGTGGACAAAGAAGGCTGG + Intergenic
937828612 2:126395509-126395531 TAGAACTGATAAAAGAATTCAGG - Intergenic
938084494 2:128389850-128389872 CAAAACTGGGAAATGAAGATGGG - Intergenic
938311911 2:130296373-130296395 CTGATTGGGGAAAAGAAGTCAGG - Intergenic
940647353 2:156405533-156405555 CAGAATTAGCAAAAGAAGTGGGG - Intergenic
940861018 2:158770932-158770954 GTGAACTGAGAAAAGAAGACCGG - Intergenic
941307053 2:163882959-163882981 CAGAATTAGCAAAAAAAGTCTGG + Intergenic
943391939 2:187280927-187280949 CAGAGCTGGGAAAAGTAGTAGGG - Intergenic
943540562 2:189208777-189208799 CAGAACAGGGTACAGAAGTATGG - Intergenic
943824121 2:192366766-192366788 CAGAAGTGGGAATAGAATTCAGG + Intergenic
944115006 2:196176542-196176564 CAGAACTGGGACTTGAAGGCAGG - Intergenic
944150255 2:196550263-196550285 CAGGACTAGGAAATGAAGTCTGG - Intronic
944176859 2:196839687-196839709 AAGAACTGAGAAGAGAAGTTAGG + Exonic
944935949 2:204568423-204568445 TAGAACTGGCAATAGAAGGCAGG + Intronic
944969720 2:204978151-204978173 CAGAACAGGGCATAGAAGACTGG + Intronic
945511339 2:210706651-210706673 CAGTACTGGGATAAGAGTTCAGG + Intergenic
945726792 2:213479715-213479737 CAGCACTGGGAAGACAAGTGTGG - Intronic
946235285 2:218320990-218321012 CGGGACTGGGAAAAGGAGTGAGG - Intronic
946313509 2:218895703-218895725 CAGGACTGGGATAAGAAGGTGGG + Intronic
947197896 2:227586885-227586907 CAGCACAGTGAAAAGAAGGCAGG + Intergenic
947415218 2:229888494-229888516 AAGCACTGGGAAAATAAATCAGG + Intronic
947867373 2:233408580-233408602 CAGAGCTGGGACATGCAGTCAGG - Intronic
948216993 2:236239455-236239477 CAGAACTGGGACCAGAGGGCGGG - Intronic
948217009 2:236239534-236239556 CAGAACTGGGACCAGAGGGCGGG - Intronic
1168857119 20:1016569-1016591 CAGAGCTGGGAAAAGGATTTGGG - Intergenic
1169550970 20:6700891-6700913 CAGAAGGGGCAAAATAAGTCAGG + Intergenic
1169810119 20:9601327-9601349 CAGAATGGGGGAAAGAGGTCAGG + Intronic
1169842879 20:9959567-9959589 AATAAATGGGAAAAGAAGGCTGG + Intergenic
1170269027 20:14503193-14503215 CAGGCCTGGAAAAAGAAGTAGGG + Intronic
1170916826 20:20634675-20634697 AAGAACAGGGATAGGAAGTCTGG - Intronic
1171977329 20:31604041-31604063 CAGAGCTGGAAAGAGAACTCAGG + Intergenic
1172408495 20:34705884-34705906 CAGGGCTGGGAAAGGAAATCTGG + Intronic
1173855586 20:46248434-46248456 CAGACCTGGGAAAAGACCTTTGG - Intronic
1175475741 20:59272871-59272893 CAGAGCTGGGAAATGAAGACTGG - Intergenic
1177830800 21:26136821-26136843 CAGATCTGGCAACAGAAGACAGG - Intronic
1178785944 21:35653291-35653313 CAGACCTGGGACCAGAACTCAGG - Intronic
1179505334 21:41836074-41836096 CACAACTGGGAAGAGAACCCTGG + Intronic
1179781233 21:43702274-43702296 GAGAATGGGGAAAAGAAGACAGG + Intergenic
1180900262 22:19366407-19366429 CAGATCTGGGCAAAGTAATCTGG + Intronic
1181967352 22:26666522-26666544 CAGAGCTGGGATCAGAATTCTGG + Intergenic
1182043028 22:27253260-27253282 CAGAACTGGGACTTGAGGTCAGG - Intergenic
1182322494 22:29487207-29487229 CAGAACTGGGACAAGTCCTCAGG - Intronic
1183332426 22:37228713-37228735 CAGAGCTGGGGGGAGAAGTCGGG + Intronic
1183668521 22:39258428-39258450 CAGAGATGGGATGAGAAGTCAGG - Intergenic
1184015357 22:41781907-41781929 CAGAGCTGGGACCAGAACTCAGG - Intronic
1184448811 22:44570772-44570794 CAGCACTGAGAAGAGGAGTCAGG - Intergenic
949645258 3:6086007-6086029 CAGAAATTGGAAAAGAAGCTGGG - Intergenic
949801532 3:7909738-7909760 CAGAACTGGAAAGAGAACTTAGG + Intergenic
950355720 3:12407087-12407109 CAGAATTGGGACTAGAATTCAGG - Intronic
950445935 3:13038486-13038508 CAGAATTGGGAAGGGTAGTCGGG + Intronic
950630387 3:14278350-14278372 CAGAAATGGGAAGAGAGGCCAGG - Intergenic
952075426 3:29690682-29690704 CAGAACTTGAAAGAGAATTCTGG - Intronic
952110559 3:30119361-30119383 CTGAACTGGAAAAAGTAGACTGG - Intergenic
952173073 3:30830725-30830747 CAAATCTAAGAAAAGAAGTCTGG - Intronic
952175760 3:30860884-30860906 TAGAGCTGGGAAAGAAAGTCAGG - Intronic
952615199 3:35262825-35262847 CAGAACTGGGGCAAGATGTGGGG - Intergenic
953346061 3:42176638-42176660 TGGAACTGGGAAATGAAGTCTGG + Intronic
953566041 3:44032875-44032897 TAGAAATGGGAAAAGAACACAGG + Intergenic
953566862 3:44039552-44039574 CACAACAGGGAAAAGAAATAAGG + Intergenic
954048098 3:47950305-47950327 CAGAACTGGTACAAAAAGTAGGG + Intronic
954436810 3:50500588-50500610 CATAACTGGAAAAAGGAGGCAGG + Intronic
955193731 3:56785650-56785672 CAGAAGAGGAAAAAGAAGTAGGG + Intronic
955532440 3:59888032-59888054 CAGAGCTTGGAAAATAAGACGGG + Intronic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
958530389 3:95322618-95322640 GAGAACTGGGAACAAAAGTGAGG - Intergenic
959430525 3:106249831-106249853 AAGATCTGGGAAAGGAAGTGGGG - Intergenic
959825500 3:110790933-110790955 AAGATCTGGAAAAAGAAATCAGG - Intergenic
959933669 3:112008638-112008660 CTGAACTGGCAAAACAAGACAGG + Intronic
961004686 3:123396985-123397007 CGGAACTGGGAAAGGAAGAAAGG + Intronic
961155088 3:124672760-124672782 CAGAACTGGGAATAGAAACCAGG - Intronic
962362182 3:134751864-134751886 CAGAAAGGGAAAAAAAAGTCTGG + Intronic
963341067 3:144034437-144034459 CAGAACTTGGGAAGGAAGTGTGG + Intronic
963892470 3:150651018-150651040 GGGCACTGGGAAAAGAAATCAGG + Intergenic
963906053 3:150774410-150774432 CAGACATGGGACAAGAACTCAGG - Intergenic
964091335 3:152879619-152879641 GAGAAAGGGGAAAAGAAGTTTGG - Intergenic
964275932 3:155008957-155008979 CAGAACTGGCACCAGAAGTAAGG - Intergenic
964308093 3:155362080-155362102 AAGTACTGGGTAGAGAAGTCTGG - Intergenic
964324919 3:155535185-155535207 TAGAACTGGGGAAAGAATACAGG + Intronic
964517822 3:157531855-157531877 TAGAAATGGGAAAGGAAATCAGG - Intronic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
966270973 3:178105108-178105130 TAGAGCAGAGAAAAGAAGTCTGG - Intergenic
966592849 3:181700675-181700697 CAGTACTGGGAAAAGCAGCTGGG + Intergenic
966793187 3:183691727-183691749 CTGACCCTGGAAAAGAAGTCCGG - Intergenic
969355284 4:6621348-6621370 CAGGACAGGGAAAAGCAGTGCGG + Exonic
969377638 4:6773382-6773404 CAGAGCTGGGACAACAAGTCAGG - Intergenic
969417865 4:7072895-7072917 CAGAACTGTGAAAAGCACTGTGG + Intergenic
969940694 4:10728081-10728103 CAGAACTGGGGAAAGGCTTCTGG + Intergenic
970492008 4:16584428-16584450 CAGAACTGGGACTTGAACTCAGG - Intronic
970682941 4:18532461-18532483 CAGAACTAGGATGAGAATTCTGG + Intergenic
971052873 4:22880918-22880940 CAAACATGGGAAAAGAAGTGAGG - Intergenic
972071636 4:35026744-35026766 CAGAACTGGGAAGAGAAAATGGG - Intergenic
972153679 4:36129320-36129342 AGGAACAGGGAAAAGAAGCCTGG - Intronic
973656414 4:53052924-53052946 CAGAACTGGCAAAACAGGCCAGG + Intronic
973689734 4:53414348-53414370 CAGAAATGAGAAAAGAACTAAGG - Intronic
975606773 4:76162863-76162885 CAGAACTGGGATTTGAACTCAGG + Intronic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
977327072 4:95587567-95587589 AGGAAGTGGGAAAAGAAATCAGG - Intergenic
977593379 4:98851221-98851243 CAGAACTGGGTGAGGAAGACTGG + Intergenic
978061528 4:104345382-104345404 CAGATGTGGGACAAGAACTCAGG + Intergenic
978470774 4:109065027-109065049 CAGAACTGTGACAAGAACTCGGG + Intronic
980242500 4:130195037-130195059 CAGAACTGGTAAAAGGAACCTGG + Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
981169841 4:141609024-141609046 CAGAACTGGGAAAAGGATGGAGG + Intergenic
981573396 4:146177202-146177224 CAGAGCTGGGATTAGAACTCAGG + Intronic
983591529 4:169417455-169417477 CAGAATTAGGAAGAGAAGTTAGG + Intronic
984839582 4:184055814-184055836 CAGAACTCAGAAAAGAGGTAAGG - Intergenic
986902761 5:12457401-12457423 CAGAAATGGGAAATGAAGGATGG + Intergenic
987482716 5:18478568-18478590 CAGAACTTGGATAAGATGTGAGG + Intergenic
988321451 5:29703260-29703282 CAGAACTAGGAAACGAAATATGG - Intergenic
989011798 5:36879336-36879358 TAGAATTGGGAAAATAAGTTGGG - Intronic
989181993 5:38587515-38587537 CAGAACTAGCAAGAGAAGACTGG + Intronic
989510038 5:42275753-42275775 AAGAACTGGGAAAAATATTCTGG - Intergenic
989539126 5:42598369-42598391 AAGAACTGGGAAAACACCTCTGG + Intronic
989732536 5:44665088-44665110 CAGAAGCGGGACAAGAACTCAGG + Intergenic
989766420 5:45089970-45089992 AAGAAGTGGGAAGTGAAGTCAGG - Intergenic
990181719 5:53168025-53168047 CAGAACTGAGAACAGAAACCAGG + Intergenic
991248712 5:64535129-64535151 GAGCACTGGGAACAGAAGTCTGG + Intronic
991281844 5:64923341-64923363 CAGGACTGGGAAAGACAGTCGGG + Intronic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
991998077 5:72408023-72408045 GAGAACTGGGAAGAGAAGACAGG + Intergenic
992441528 5:76801512-76801534 GAGAACTGGGAAAGGGAGGCTGG + Intergenic
993277490 5:85879267-85879289 TAGAACTGATAAAAGAATTCAGG - Intergenic
994659474 5:102636382-102636404 CAGCACTGGAAAAAGAAGGCAGG + Intergenic
995283487 5:110360740-110360762 CAGAAATGGAAGAAGAAGTGGGG - Intronic
995468111 5:112471510-112471532 CAGCTTTGGGAAAAGAAATCTGG - Intergenic
996106481 5:119510514-119510536 CAGTATTGGGAAAAGACTTCTGG + Intronic
996150771 5:120031901-120031923 GAGAAATGAGAAAAGAAGTGAGG - Intergenic
996288594 5:121825330-121825352 TAGAACTGATAAAAGAATTCAGG - Intergenic
996703864 5:126477225-126477247 CAGAACTGAGCCAAGAATTCAGG + Intronic
997274943 5:132577779-132577801 CAGAAATGGGTAAATAGGTCTGG - Intronic
997992294 5:138554876-138554898 CAGAAATAGGGAAAGAAATCTGG + Exonic
998226693 5:140332607-140332629 CAGAGCTGGGACTAGTAGTCTGG - Intergenic
999430708 5:151522892-151522914 CAGAACTGTGAAAAGCCGTGAGG + Intronic
999797718 5:155003965-155003987 CAGAGTTGGGAAAAGAACCCAGG - Intergenic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1001092975 5:168755212-168755234 CAGAACTGGGATTTGAAGCCAGG + Intronic
1001248877 5:170129817-170129839 CAGAAATGGAAAAAAAAATCTGG + Intergenic
1002680097 5:180955128-180955150 CAGATCTGGGATGTGAAGTCAGG - Intergenic
1002857360 6:1050183-1050205 AGGAACTGGGAAAAGACTTCTGG + Intergenic
1004046662 6:12031629-12031651 CAGAACTGGGATAGGGAGACAGG + Intronic
1004332674 6:14735974-14735996 CAGCACTGGGATAGGAATTCAGG - Intergenic
1004406400 6:15337599-15337621 CTGAACTGGGAAAAGACATAAGG + Intronic
1005642172 6:27806979-27807001 CAGCACTAGGAAAACAAGGCTGG - Intergenic
1007527255 6:42507433-42507455 CAGAGCTGGGAGTAGAATTCAGG - Intergenic
1009743225 6:67775843-67775865 AAGTACTTGGGAAAGAAGTCTGG - Intergenic
1009828685 6:68901027-68901049 TAGACTTGGGAAAAGAAGTAGGG - Intronic
1009917893 6:70018676-70018698 CGGAATGGGGAAAATAAGTCAGG + Intronic
1010344382 6:74794536-74794558 AAGTACTGGGAAAAGACGGCAGG + Intergenic
1010632627 6:78216728-78216750 TAGAACTGGAAAAAGAAGTTGGG + Intergenic
1012510153 6:99993270-99993292 GAGAACTGGGGAAAGTAGGCAGG - Intronic
1012569348 6:100702491-100702513 CAGAGCTCAGAAAAGAGGTCTGG + Intronic
1013438529 6:110138473-110138495 CAGACGTGGGACAAGAACTCGGG - Intronic
1013526396 6:110978153-110978175 ACAAACTAGGAAAAGAAGTCAGG + Intergenic
1014213291 6:118729329-118729351 GAGAGCTGGGAAATGTAGTCAGG + Intergenic
1015254047 6:131158308-131158330 AAGGATTGTGAAAAGAAGTCTGG - Intronic
1016664294 6:146617308-146617330 CAGAACTGAAAAATGAATTCAGG - Intronic
1016795685 6:148114756-148114778 CAGAGCAGGGAACAGAGGTCTGG + Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017952531 6:159148312-159148334 CAGAGCTGGGACAAGAAGGCAGG + Intergenic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018313586 6:162534962-162534984 GAGAACTGGGGAAGGAAGACTGG - Intronic
1019517332 7:1445840-1445862 CAGAGCTGGGGACAGAAGTAGGG + Intronic
1021138033 7:16990088-16990110 AAGAACCAGGGAAAGAAGTCTGG - Intergenic
1021226198 7:18029264-18029286 CAGAAATGGGATAAGAAATGGGG + Intergenic
1021479776 7:21103397-21103419 CAGAACTGTTAAAAGCAGGCAGG + Intergenic
1021601421 7:22367940-22367962 CAGAAATGGGAAAAGCTGGCTGG + Intergenic
1021655316 7:22868564-22868586 CAGAACTGGGATAAGGAGAGAGG - Intergenic
1021931961 7:25589956-25589978 CAGAAGTGGGAACTGAAGTAGGG - Intergenic
1022062525 7:26812169-26812191 CAAAAGAGGGAAAAGAAGTGAGG - Intronic
1022253545 7:28632395-28632417 CAGGACTAGGAAGAGATGTCAGG + Intronic
1023037991 7:36149639-36149661 CAGCTCCGGGAATAGAAGTCAGG + Intergenic
1023275455 7:38514660-38514682 CACAAAACGGAAAAGAAGTCAGG - Intronic
1024224072 7:47312337-47312359 TAGTACTGGGAATAGAAGTGAGG - Intronic
1024848699 7:53682901-53682923 AAGAACTGGAGAAAGAACTCTGG - Intergenic
1025869349 7:65416197-65416219 AAGAAGTGAGAAAAGAAGTTTGG + Intergenic
1026806034 7:73430113-73430135 CAGAGCTGGGGAAACAAGCCTGG + Intergenic
1029486730 7:100847520-100847542 CAGAAGTGGGAAAACCAGTTAGG + Intronic
1030079973 7:105769014-105769036 CAGAGCTGGGACTAGAAGTCAGG - Intronic
1030288079 7:107847339-107847361 CAAAACTGTGAAAAGAAGAGTGG + Intergenic
1031338683 7:120571176-120571198 CTGAACTAGGAACAGATGTCTGG - Intronic
1032294833 7:130627221-130627243 CTAATCAGGGAAAAGAAGTCAGG + Intronic
1032454307 7:132060537-132060559 CAGAACTGGTAAAACTAGTGGGG + Intergenic
1032663427 7:134011349-134011371 GAGAACTGGGAAGAAAACTCTGG - Intronic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1035019840 7:155794387-155794409 CAGAACTGGGAAGAGGTGCCAGG + Intergenic
1035432582 7:158833459-158833481 CAGACATGGGAAAAGAAGTGTGG + Intergenic
1036736505 8:11322748-11322770 CAGAACTGGAAACAGAGGACGGG + Exonic
1037424420 8:18740162-18740184 CAGACCTGGGAACAGAAGACAGG - Intronic
1037550008 8:19961337-19961359 GAGAGCTGGGATTAGAAGTCAGG + Intronic
1037578335 8:20228847-20228869 AAGAACTGGGATTGGAAGTCAGG + Intergenic
1037617070 8:20529181-20529203 CCCAACTGGGAGAACAAGTCAGG - Intergenic
1037631669 8:20663045-20663067 CAGAACTGGACAAAGAACTGTGG - Intergenic
1037857429 8:22381842-22381864 CAAAAATGGGCAAAGAAGGCTGG + Intronic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1039931097 8:41989998-41990020 AAGAACTGGGGAAGTAAGTCAGG + Intronic
1040664671 8:49618636-49618658 CAGAGCTGGGAAAACAGCTCAGG + Intergenic
1040669143 8:49666082-49666104 CAGAACTGAGAATAGAGGCCTGG - Intergenic
1041682640 8:60608636-60608658 AAGAACTGGTAAAAAAAATCTGG - Intronic
1042595745 8:70446227-70446249 GAGAACTGGGAGAAGCAGTAGGG + Intergenic
1042658988 8:71133242-71133264 TAGAGCTGGGATAGGAAGTCAGG + Intergenic
1042670247 8:71254672-71254694 CAGAAGTGGCAAAAGCAGCCTGG - Intronic
1043309900 8:78845136-78845158 TAGAACGGGTAAGAGAAGTCAGG + Intergenic
1043446444 8:80324221-80324243 CAGAGCTGGGAGAAGAACTGGGG + Intergenic
1043876031 8:85487411-85487433 TAGAACTGATAAAAGAATTCAGG - Intergenic
1044050609 8:87498300-87498322 AAGAAGTGGGACAAGAAGACAGG - Intronic
1044284241 8:90393005-90393027 AAAGACTGGGAAATGAAGTCCGG + Intergenic
1045326578 8:101121870-101121892 CAGAAGTGGGGAAAGAAGAAAGG - Intergenic
1045565275 8:103308331-103308353 CAGAACTGGTATTAGGAGTCCGG - Intronic
1046051668 8:109030139-109030161 CATAACTGGGAAGACAAGTCAGG - Intergenic
1046711937 8:117520523-117520545 CAAGACTGGGAAACGAACTCTGG + Intergenic
1047001027 8:120572466-120572488 AAGAGCTGGCAAGAGAAGTCAGG + Intronic
1047601590 8:126431099-126431121 CAGAACTGGGCACTGAAGCCAGG + Intergenic
1047773104 8:128046396-128046418 CAGAGCTGGGATCTGAAGTCCGG + Intergenic
1047861697 8:128974180-128974202 CAGAACAGGGAAACTGAGTCTGG - Intergenic
1052619160 9:30883221-30883243 CAGAACTAGCACAAGAACTCTGG - Intergenic
1052974992 9:34403542-34403564 CAGACCTTGGCAAAGGAGTCAGG - Intronic
1053420026 9:37971474-37971496 CAGACATGGGAAGAGAAGGCTGG + Intronic
1054726445 9:68656488-68656510 AAGAAATGGGGAAAGAAATCTGG + Intergenic
1054896200 9:70314223-70314245 CAGGAGTGGGGAAAGAATTCTGG - Intronic
1056890345 9:90486088-90486110 CAGAACGGTGAAACAAAGTCAGG + Intergenic
1057191811 9:93092611-93092633 CAGAGCTGGGAAGAGCATTCTGG + Intergenic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1057985519 9:99709667-99709689 CAGCAAAGGGAAAACAAGTCCGG + Intergenic
1058140473 9:101352591-101352613 CAGGACTGGGATTAGAATTCGGG - Intergenic
1058341185 9:103898843-103898865 AAGAACTGGGATTTGAAGTCAGG - Intergenic
1058922353 9:109628947-109628969 TAGAGCTGTGCAAAGAAGTCTGG - Intergenic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1061091536 9:128429104-128429126 TAGGACTGGGAAAAGCAGACAGG + Intronic
1061643025 9:131974619-131974641 CAGAGCTGGGGACAGAAATCAGG + Intronic
1061661490 9:132133256-132133278 CAGAGCTGACAAAAGAAGTGAGG + Intergenic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1186202956 X:7172399-7172421 TAGAAGTGGGAAGAGAAGCCAGG - Intergenic
1186396907 X:9218555-9218577 CAGAACTGGGATTTGAACTCAGG - Intergenic
1186968974 X:14819357-14819379 CAGAACTGAGAAAAAAAAACAGG + Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1189083828 X:37999780-37999802 GAGAACTTAGAAAAAAAGTCTGG - Intronic
1190511223 X:51176045-51176067 CAGAACTCAGGAAAGAACTCAGG + Intergenic
1190726220 X:53192594-53192616 CAGAACTGGGGAGAGAAGGGAGG + Exonic
1192991550 X:76463736-76463758 TAGAACTGGTAAATGAATTCAGG - Intergenic
1193076235 X:77359157-77359179 CAGAATTTGGAACAGAAGCCAGG - Intergenic
1193170602 X:78331490-78331512 CAAAGCTGGGAAAAGAATACAGG + Intergenic
1194027241 X:88768065-88768087 CAGAACTGTAAAATGAATTCCGG + Intergenic
1195161084 X:102172511-102172533 CAGAACTAGGGTTAGAAGTCGGG + Intergenic
1195274904 X:103272683-103272705 CAGAACTGGGCCAAGAACTGAGG + Intergenic
1195869135 X:109467966-109467988 CAGAATTGAGATAAGGAGTCTGG - Intronic
1195953465 X:110303314-110303336 CACAACTGGGGGAAAAAGTCAGG - Intronic
1197068294 X:122261453-122261475 TTGAACTGGGAAAAAATGTCTGG - Intergenic
1197155540 X:123266242-123266264 CAGAACTGGAAAGAGAGGTTGGG - Intronic
1197641389 X:128972005-128972027 CAGAACTGGGAGACCAAGTCAGG + Intergenic
1198415406 X:136414797-136414819 CAGAACTGGGGCCAGAATTCAGG + Intronic
1198585450 X:138115791-138115813 CAGAACTGTGACTAGAACTCAGG - Intergenic
1198737668 X:139805320-139805342 CAGAGCTGGGATGAGAAGTCAGG - Intronic
1198768890 X:140107349-140107371 CAAAACTGGAAAAAAAAATCTGG - Intergenic
1199084905 X:143617264-143617286 TATAAGTGGGGAAAGAAGTCAGG - Intergenic
1199926679 X:152474151-152474173 TAGAACTGATAAAAGAATTCAGG + Intergenic
1201756097 Y:17486807-17486829 TAGAACTGATAAAAGAATTCAGG + Intergenic
1201845455 Y:18419178-18419200 TAGAACTGATAAAAGAATTCAGG - Intergenic