ID: 1157107610

View in Genome Browser
Species Human (GRCh38)
Location 18:44789434-44789456
Sequence GAAAGAAGTCAGATTCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 1, 2: 9, 3: 75, 4: 583}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157107610_1157107612 12 Left 1157107610 18:44789434-44789456 CCCTCTTGAATCTGACTTCTTTC 0: 1
1: 1
2: 9
3: 75
4: 583
Right 1157107612 18:44789469-44789491 AATATAGAAAAAAATAAGACAGG 0: 1
1: 0
2: 26
3: 973
4: 24538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157107610 Original CRISPR GAAAGAAGTCAGATTCAAGA GGG (reversed) Intronic
901268142 1:7928558-7928580 GAAAGTTGTCAGAATCAAAATGG + Intronic
902058572 1:13622551-13622573 GAGAGAAGACGGCTTCAAGAAGG - Intergenic
902798211 1:18813348-18813370 GAAAGCAGCCAGTTTCAACATGG + Intergenic
902847935 1:19126989-19127011 AAAAGAAGCCCAATTCAAGAAGG + Intronic
903571114 1:24306188-24306210 GAAAGAAGCCAGACACAAGAAGG - Intergenic
905333518 1:37226773-37226795 GAAAGAAATGATATTCATGATGG + Intergenic
905376141 1:37521893-37521915 GAAAGTTGTCAGAATCAAAATGG + Intergenic
905946593 1:41906421-41906443 GAAAGAAGCCAGAAGCAAAAAGG + Intronic
905999199 1:42409278-42409300 TAAAGAATTTAGAATCAAGAAGG + Intronic
906094959 1:43216623-43216645 GACAGAAGGGAGTTTCAAGAAGG - Intronic
906269568 1:44464756-44464778 AAGAGAAATCAGATTCTAGATGG - Intronic
906298830 1:44666601-44666623 GAAATAAGTCAGATACAAAGGGG + Intronic
906740364 1:48176978-48177000 GAAATAAGTCAGTTTGAAAAGGG + Intergenic
907168031 1:52432288-52432310 GAAATCAGTCTGATACAAGAAGG + Intronic
908233343 1:62127446-62127468 GAAAGTTGTCAGAATCAAAATGG - Intronic
908266358 1:62383269-62383291 GGAAGAAGCCAGATACAAAAAGG + Intergenic
908284614 1:62581815-62581837 GAAAGAAGAAAGTTTTAAGAAGG + Intronic
909437089 1:75654914-75654936 GAAAGAAGGCAGTTGAAAGAAGG - Intergenic
909447687 1:75765897-75765919 GAATGAAGTCAGTCTCAGGAAGG + Intronic
909599190 1:77443022-77443044 GAAAGTTGTCAGAATCAAAATGG - Intronic
910125157 1:83832572-83832594 GAAAGAAGCTAGACACAAGAGGG - Intergenic
910316154 1:85885967-85885989 GAAAGTTGTCAGAATCAAAATGG - Intronic
911018590 1:93363181-93363203 GAAAGAAGACAGTGTTAAGATGG - Exonic
911244367 1:95500512-95500534 GAAAGTTGTCAGATTCAAAATGG - Intergenic
911279418 1:95904039-95904061 GCAAGAAGTGAGATCCAAAAAGG - Intergenic
911766411 1:101680935-101680957 GATAGAAGTCAGTTTCATGCAGG - Intergenic
912541394 1:110418869-110418891 GAAAGTTGTCAGAATCAAAATGG - Intergenic
913282198 1:117196978-117197000 TAAAGAAGTGAGCTGCAAGATGG - Intronic
913350533 1:117853684-117853706 GAGAGAAGTGAAATTCAACAAGG + Intergenic
915074982 1:153300454-153300476 GAAAGTTGTCAGAATCAAAATGG + Intronic
915316056 1:155029831-155029853 GAAAGTAGCCAGAGACAAGAGGG - Intronic
915357198 1:155262407-155262429 GAAGGAAGTCACATGGAAGAGGG - Intronic
915679165 1:157563604-157563626 GAAAGAAGCCAGATACAAAAGGG - Intergenic
915950803 1:160188777-160188799 ACAAAAGGTCAGATTCAAGATGG + Intergenic
916090205 1:161302066-161302088 GAAAGTTGTCAGAATCAAGATGG - Intergenic
916491426 1:165305708-165305730 AAAAGAAGCCAGATTCAAGTTGG - Intronic
917068657 1:171125269-171125291 GAAAGAATTTAGATTTAAGACGG - Intergenic
917404512 1:174690132-174690154 GAAAGAGTTCAGCTTCAAAAAGG - Intronic
917467031 1:175288746-175288768 GAAAGTTGTCAGAATCAAAATGG + Intergenic
917467885 1:175299362-175299384 AAAAAAAGTCAGATTGAAAAAGG - Intergenic
917699756 1:177568419-177568441 AAAAGATGTCAGCTTCATGAGGG + Intergenic
918549315 1:185722721-185722743 GAAAGTTGTCAGAATCAAAATGG + Intergenic
918570390 1:185984220-185984242 GAAAGAGTTCAGCTTCAGGATGG + Exonic
918655315 1:187018742-187018764 GAAAGAAGATAGGTTCAAAATGG - Intergenic
918689519 1:187463638-187463660 GTGAGAAGTCAGATTTAAGCAGG + Intergenic
919348422 1:196417016-196417038 GAAATAAGTCAGACACAGGAAGG - Intronic
919939048 1:202273900-202273922 GGAAGAAGTCACATTTGAGATGG - Intronic
920573955 1:207042043-207042065 GAAAGAACTCAGACTAAAAAAGG - Intronic
920907565 1:210186087-210186109 GAACGAAATCAAAATCAAGAGGG - Intergenic
921413542 1:214863295-214863317 GAAAGAAGCTAGATTCCTGATGG + Intergenic
921883935 1:220285265-220285287 GAAAGAAGTCAGACGTAAAAGGG - Intergenic
922025608 1:221745616-221745638 GAAAAAAATCAGATTATAGATGG + Intergenic
922145991 1:222945027-222945049 GAAAAAAGTCAGATCCAAAAAGG + Intronic
922330276 1:224568813-224568835 GGAAGAAGACAGATTCTACAGGG - Intronic
922754592 1:228088627-228088649 GCAAGAATTCAGTTTCCAGAAGG + Intronic
922980225 1:229819484-229819506 GAAAGTTGTCAGAATCAAAATGG + Intergenic
923299987 1:232631348-232631370 GGAAGAAGTCTGACTCTAGAAGG - Intergenic
923804316 1:237241905-237241927 GAAACCAGCCAGAATCAAGATGG - Intronic
924161702 1:241239506-241239528 GAAAAGAGTCAGATTATAGACGG - Intronic
924303159 1:242660433-242660455 GAAAGCTGTCAGAATCAAAATGG - Intergenic
924410237 1:243796914-243796936 TAAAGCAGTCAAATTTAAGAAGG + Intronic
924872173 1:248060347-248060369 GTAAGAAGTCAGATCAAAGAAGG + Intronic
1063798835 10:9546785-9546807 GAAAGTTGTCAGAATCAAGTTGG - Intergenic
1064198698 10:13266311-13266333 GAAATAAGCCAGATGCAAAAGGG - Intergenic
1065523565 10:26594979-26595001 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1065529644 10:26655338-26655360 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1065557297 10:26929595-26929617 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1065591766 10:27269586-27269608 GAAAGAAGCCAGATACAAAAGGG - Intergenic
1065848675 10:29768035-29768057 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1066431899 10:35359866-35359888 GAAATAAGCCAGTTCCAAGAAGG - Intronic
1067203035 10:44191107-44191129 GAAAGAAGCCAGACTTAAAAGGG + Intergenic
1067537700 10:47126693-47126715 GAAGGAAGGCAGATAGAAGATGG - Intergenic
1067670546 10:48317139-48317161 GAAAGAAGCCAAGTTGAAGATGG + Intronic
1068119773 10:52773715-52773737 GAAATAAGCCAGATACAAGGGGG - Intergenic
1068709058 10:60112342-60112364 AGAAAAAATCAGATTCAAGAAGG - Intronic
1068859963 10:61838131-61838153 GAAATAAGTCAGATGTCAGATGG + Intergenic
1068958871 10:62846250-62846272 GAAAGAAGTCAGCTCAAAAATGG + Intronic
1069028186 10:63566860-63566882 AAATGGAGTCTGATTCAAGAAGG - Intronic
1070047768 10:72856136-72856158 GAAAGAAGCCAGATATAAAAGGG + Intronic
1070097960 10:73356752-73356774 GAAAGAAGACTGATACAAAAGGG - Intronic
1070489082 10:76958948-76958970 GAAAAACTTAAGATTCAAGAAGG - Intronic
1070985003 10:80681149-80681171 GTATGAGGTCAGATGCAAGATGG - Intergenic
1071112923 10:82183129-82183151 AAATGCACTCAGATTCAAGAAGG - Intronic
1071178673 10:82957466-82957488 GAAAGTTGTCAGAATCAAAATGG + Intronic
1071699872 10:87919745-87919767 GAAAGAAGCCAGACACAAAAAGG - Intronic
1071724095 10:88178542-88178564 GGATGAATTCAGAGTCAAGAGGG - Intergenic
1071845100 10:89513889-89513911 AAAAGAAGTCAGATTCTGGATGG + Intronic
1071943833 10:90618133-90618155 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1072156816 10:92731137-92731159 GAAAGAAATCAGTTTAGAGAAGG - Intergenic
1072176809 10:92932714-92932736 GGAAGATGTGAGATGCAAGAAGG + Intronic
1072535655 10:96360654-96360676 GAAAGAAATTTGATTCAAGAAGG + Intergenic
1072831483 10:98663286-98663308 GAAGGAACTTAGATTCTAGAAGG + Intronic
1072971987 10:100025370-100025392 GAAAGAAGAAAGATCAAAGAAGG + Intergenic
1073046538 10:100642426-100642448 GAAAGGAGACAGTTTCAAGGAGG + Intergenic
1073218645 10:101851529-101851551 GAAATAAGCCAGAGTCAGGATGG + Intronic
1073353795 10:102837743-102837765 GACAGATGACAGATTCAGGAGGG + Intergenic
1073456467 10:103639760-103639782 GAAAGATGGAAGATGCAAGAAGG + Intronic
1073644086 10:105281693-105281715 GAATGAAGTCAGATGCAGAAAGG - Intergenic
1073671922 10:105600748-105600770 GAAAGAAGCCAGATCAAAAAAGG + Intergenic
1074539271 10:114351360-114351382 GAAAAAAGACATATTAAAGATGG + Intronic
1074786678 10:116848232-116848254 GAGAGAAGGCAGGTTCATGATGG + Intergenic
1076194060 10:128502634-128502656 GAAAGAAGTCAGAATAGTGAAGG - Intergenic
1077482774 11:2824301-2824323 GAAAGAAGACAGATACGAGAGGG + Intronic
1078184152 11:9037526-9037548 GAAAGCAGTCAAATACTAGAGGG - Intronic
1078693796 11:13608647-13608669 GAAAGAAGCCAGAGACAAAAGGG - Intergenic
1079020304 11:16905511-16905533 CAAAGAAGTCAGCTTGGAGAGGG - Intronic
1080453022 11:32394261-32394283 GAAGGAAATCAGACTCAATAGGG - Intronic
1080555317 11:33410881-33410903 GGAGGAAGACAGTTTCAAGAAGG + Intergenic
1081010437 11:37804537-37804559 GAAAAAAGTCTAATTCAAAACGG - Intergenic
1081266727 11:41033257-41033279 GAAAGAAGTCACAAGCATGAAGG + Intronic
1082683439 11:56208291-56208313 GAAAGCTGTCAGAATCAAAATGG + Intergenic
1082725356 11:56728298-56728320 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1083128298 11:60595882-60595904 GAAACATATCATATTCAAGAGGG + Intergenic
1086557400 11:88127303-88127325 GAAATAAGGCAGATTCAAGTTGG + Intronic
1089151311 11:116366557-116366579 GAGACCAGACAGATTCAAGAAGG - Intergenic
1090559559 11:127916874-127916896 GAAATAAGTCATATTCAAATAGG + Intergenic
1091120468 11:133053376-133053398 GAAACAAGGCAGTTACAAGAGGG - Intronic
1091130296 11:133140674-133140696 GAAAGAAGAAAGATGGAAGACGG + Intronic
1091178624 11:133583144-133583166 GGAAGAAGACAGATTCAGAAAGG + Intergenic
1091388866 12:112945-112967 GAAACAAGGCAGTTTCAAAAAGG + Intronic
1091618683 12:2068937-2068959 GAATGAACTCAGAGTCCAGATGG + Intronic
1091899313 12:4132180-4132202 GGAAGAATTGAGATGCAAGAAGG - Intergenic
1093816762 12:23558426-23558448 GAAGGCAGGCAGATTCAGGAAGG - Intronic
1095161420 12:38921083-38921105 GATAGAAGACAGATAGAAGATGG + Intergenic
1095358140 12:41301877-41301899 GAGACATGTGAGATTCAAGAAGG - Intronic
1095526472 12:43131689-43131711 GAAAGAAGACAGATAGAAGAAGG - Intergenic
1095589321 12:43886458-43886480 GATAGAAGTCAGATTGCAGTTGG + Intronic
1095707324 12:45251430-45251452 GCAAACAGTCTGATTCAAGATGG + Intronic
1095745934 12:45659060-45659082 GAAAGCTGTCAGAATCAAAATGG + Intergenic
1096283702 12:50279495-50279517 GAAAGAAATCAGATTATAAAGGG + Intronic
1097227390 12:57486259-57486281 AAAAAAATTGAGATTCAAGATGG - Intronic
1097839646 12:64309388-64309410 GAAATAAGCCAGATACAAAAGGG - Intronic
1098331166 12:69355038-69355060 GATAGAAGCCAGATTAGAGAGGG - Intergenic
1098429659 12:70406010-70406032 GAAAGAAGCCAGACACAAAAAGG + Intronic
1098844290 12:75516992-75517014 GAGAGAAGTCACAATCAAAAAGG - Intergenic
1098985223 12:77004947-77004969 GAAGTAAGTCAGAGACAAGAAGG + Intergenic
1099155732 12:79173576-79173598 CAAAGAAGAAAGATTCCAGATGG + Intronic
1099262435 12:80400110-80400132 GAAAGACATGAAATTCAAGATGG + Intergenic
1099479789 12:83151369-83151391 GAAAAAACTCAGAGCCAAGAAGG + Intergenic
1099677521 12:85781078-85781100 AAAAGAAGTATGATTCAAGACGG - Intergenic
1100099431 12:91085532-91085554 GAGAGAAGTCAAATTTAAAAGGG - Intergenic
1100442787 12:94632034-94632056 GAAAGAAGCCACACTCAAAAAGG + Intronic
1100455445 12:94747318-94747340 GAAAGCTGTCAGAATCAAAATGG - Intergenic
1100591060 12:96030027-96030049 GCAAGAAGCCAGATGGAAGAAGG - Intronic
1100842242 12:98624519-98624541 GAAAGCAGTCAGTTACAAAAAGG - Exonic
1101675292 12:106911731-106911753 AAATGAAGTCAAACTCAAGAAGG - Intergenic
1101701093 12:107174687-107174709 GGAAGAAGTCAAACTCCAGATGG + Intergenic
1102078418 12:110078531-110078553 GAAAAAATTCAGATACAAGCAGG - Intergenic
1102614103 12:114138163-114138185 AAAAGAAATCAGCTTTAAGAGGG + Intergenic
1102794110 12:115673583-115673605 GAAAGAAGTTAGGTTGGAGAGGG - Intergenic
1102799629 12:115720443-115720465 GAAAGAAGCCAGACACAAAAGGG + Intergenic
1103044898 12:117727944-117727966 GAAAGAAACCAGATACAAAAGGG + Intronic
1103131541 12:118473244-118473266 GAAAGAACTCAGTTTCCAGGGGG - Intergenic
1103229128 12:119313362-119313384 GAAAGTTGTCAGAATCAACAGGG - Intergenic
1103275390 12:119707379-119707401 GAAAGTTGTCAGAATCAAAATGG + Intronic
1103589374 12:121980386-121980408 GAAGGAAGTGAGAATGAAGAGGG - Intronic
1103805063 12:123565847-123565869 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1104053676 12:125213178-125213200 GAAAGAAGCCAGACCCAAAAGGG - Intronic
1104154995 12:126122716-126122738 GAAAGCTGTCAGAATCAAAATGG - Intergenic
1105050619 12:133047215-133047237 GAAAGTTGTCAGAATCAAAATGG + Intronic
1106343337 13:28852222-28852244 AAAATAAGTCAGAATAAAGAGGG - Intronic
1106929452 13:34648145-34648167 GAAAGGAGTCATATTCAGAAAGG + Intergenic
1106950614 13:34879694-34879716 GCAAGAAGTCAGAATAAACAAGG - Intergenic
1107188785 13:37555004-37555026 GAAACAAGTCAGATGCACAAAGG + Intergenic
1107340007 13:39395743-39395765 GGAGGAAGTCACATTCTAGAAGG + Intronic
1107458394 13:40576813-40576835 GAAAGCAGTCAGCTTCATGGAGG - Intronic
1107984551 13:45764292-45764314 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1108148219 13:47502010-47502032 TAAAGATGGCAGATACAAGATGG + Intergenic
1108905410 13:55464968-55464990 GAAGGAAGTGAAATTAAAGAAGG - Intergenic
1109256947 13:60095257-60095279 GAAAGAATTCAAAGGCAAGATGG + Intronic
1109549938 13:63882107-63882129 GAAAGTAGTCAGAATTAACATGG + Intergenic
1110006654 13:70280541-70280563 AAAAGCAGACAGAATCAAGAGGG - Intergenic
1110055645 13:70967375-70967397 AACACAAGCCAGATTCAAGAGGG + Intergenic
1110075383 13:71234451-71234473 GAAAGAATTCAGAGACAAAAGGG + Intergenic
1110400783 13:75089108-75089130 GAAAGATGTCAGAATCAAAATGG + Intergenic
1110777588 13:79427336-79427358 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1111063133 13:83050553-83050575 GACAGAAGCCAAATACAAGAAGG + Intergenic
1111586341 13:90288669-90288691 GAAAGAATTCAGGTTATAGAAGG + Intergenic
1112705505 13:102064140-102064162 GAAAGAACTGATATTTAAGATGG + Intronic
1112901983 13:104368128-104368150 GAAAGTTGTCAGAGTCAAAATGG + Intergenic
1113414991 13:110121957-110121979 GAGAGAAGTCAGATCAAAGGTGG + Intergenic
1113447322 13:110379414-110379436 GAAAGAAATGAGCTGCAAGATGG - Intronic
1114232378 14:20795317-20795339 GAAAGTTGTCAGAATCAAAACGG - Intergenic
1114812700 14:25918575-25918597 GAAAGAAGTCAGATAAAAGAGGG + Intergenic
1115067465 14:29282057-29282079 GAGAGAAGACAGGTTGAAGAGGG - Intergenic
1115549780 14:34494718-34494740 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1116190088 14:41653911-41653933 AAAAGAAGTCAGATTCATCTTGG - Intronic
1118236425 14:64009087-64009109 GAAAGAATTGAGATTCAAAGAGG + Intronic
1118804383 14:69222387-69222409 GAAAGATGTCAGATTAAAGTTGG - Intronic
1119052292 14:71381415-71381437 GAAAGAAGCTAGATTATAGAGGG + Intronic
1119629874 14:76220073-76220095 AAAAGTTGTCAGATTCAAAATGG - Intronic
1119770063 14:77214930-77214952 GAGAGAAATAAGATGCAAGATGG - Intronic
1120102291 14:80459074-80459096 GAAAAAAGTCAGATTCATAAAGG - Intergenic
1120333983 14:83130101-83130123 GAAAGAAGTAAGAATTATGAAGG - Intergenic
1120755713 14:88242245-88242267 GAAATAACTCAGATGAAAGAAGG - Intronic
1120758861 14:88268485-88268507 GAGAGAAGCCAGATTAAAAAGGG + Intronic
1121021321 14:90581900-90581922 GAACGAAGTCAGGATCATGACGG + Intronic
1121462023 14:94087758-94087780 AAAAGCAGTCAGAGTCAAAATGG - Intronic
1122006316 14:98706739-98706761 GAAATAAGCCAGGTACAAGAGGG - Intergenic
1122827964 14:104380677-104380699 GAAAGCAGGCAGATTCTGGAAGG + Intergenic
1122948712 14:105028391-105028413 GAAAGTTGTCCGATTCAAAACGG + Intergenic
1123103311 14:105820300-105820322 GAAAGTCGTCAGAATCAAAATGG - Intergenic
1123131404 14:105988534-105988556 AAGAGGAGTCAGATTCAAGGCGG - Intergenic
1123135096 14:106020947-106020969 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1124142605 15:27089803-27089825 GAAAGAAGCCAGTCACAAGAGGG - Intronic
1124433474 15:29627744-29627766 GAAATAAGCCAGACTCAAAAAGG - Intergenic
1124451350 15:29794413-29794435 GAAAGAAGCCAGGTACAAAATGG + Intronic
1124644657 15:31429318-31429340 GAAATAAGCCAGATACAAAAGGG + Intronic
1125011391 15:34879812-34879834 GAAAGCAGGCAGAGTTAAGAGGG + Intronic
1125809022 15:42520421-42520443 GAAAGCAGACAGATTTAAAATGG + Intronic
1126646335 15:50878552-50878574 AAAAGAAGCCAGATACAAAATGG + Intergenic
1126901580 15:53319885-53319907 GGGAGAAGACAGATTTAAGAAGG - Intergenic
1127394256 15:58530767-58530789 GAAAGAAGCTAGATTTAAAAGGG - Intronic
1130321403 15:82845615-82845637 GAAAGAATTTAGCTTCTAGAAGG + Intronic
1130952095 15:88600244-88600266 TCTAGAAGTCAAATTCAAGATGG + Intergenic
1131363995 15:91822045-91822067 GATACAAGTCAGCTTCTAGAGGG + Intergenic
1132039170 15:98510791-98510813 GAAAGAAGTCAGGCACAAAAGGG + Intronic
1133735740 16:8614278-8614300 GAAAGAAGCCAGCCTGAAGAGGG + Intergenic
1135161964 16:20104293-20104315 GAAAGAAGTCAGACTCATTAAGG - Intergenic
1135562759 16:23489092-23489114 GAAGGAACTCAGGTTCAGGATGG - Intronic
1136041600 16:27583855-27583877 CAAAGAAGGCAGAGTCAAGAGGG - Intronic
1137317636 16:47344012-47344034 GAAATAAGTCAGACACAAAAGGG + Intronic
1137864728 16:51881589-51881611 GAAAGAAGTTAAGTTCTAGATGG - Intergenic
1138112942 16:54338954-54338976 GAAAGAAGTCAGACACAAAAGGG - Intergenic
1138604420 16:58079041-58079063 GAAAGAAGCCAGACACAAGCAGG + Intergenic
1139133212 16:64170825-64170847 GAAAGAATAGAAATTCAAGATGG + Intergenic
1139669406 16:68481880-68481902 GAAAGTACACAGAGTCAAGACGG - Intergenic
1140812327 16:78590376-78590398 TAAGGAAGACAGATCCAAGATGG + Intronic
1141085283 16:81089964-81089986 GAAACATGTCCTATTCAAGAAGG - Intronic
1141783282 16:86179562-86179584 GAAGGAAGTCAGATGCAATAGGG + Intergenic
1143754885 17:9059554-9059576 GAAAGAAGCCAGACACAAAAGGG + Intronic
1144256856 17:13476890-13476912 GAAAGAAGTCTTATGCAACAAGG + Intergenic
1145776068 17:27529906-27529928 TAAAGACCTCAGATTCAAGTGGG - Intronic
1146890528 17:36503688-36503710 GACAGAAGCCAGACTCAGGAGGG - Intronic
1148673541 17:49431517-49431539 GAAAAAAGCCAGACTCAAAATGG + Intronic
1148832897 17:50446761-50446783 GAAAGAAGCCAGATTTTAAAAGG - Intronic
1148891005 17:50807071-50807093 GAAAGAAGCCAGACACAAAAAGG + Intergenic
1149586990 17:57796819-57796841 GAAAGAAGCCAGACACAAAAAGG - Intergenic
1150035327 17:61790211-61790233 GAAGGAAACCAGATTCAAAAGGG - Intronic
1150719992 17:67606238-67606260 GAAAGAAATGAGAGACAAGAGGG + Intronic
1151873611 17:76853272-76853294 GAAAGAAGTCAAACACAAAAGGG - Intergenic
1152522697 17:80868834-80868856 GAAAGAAGCCAGTTTAAAGAAGG + Intronic
1153192645 18:2559336-2559358 GAAATAAGCCAGATGCAAAAGGG + Intronic
1153769499 18:8403821-8403843 GAAAGAAATCAGATTCAAAAGGG - Intronic
1153788196 18:8553724-8553746 GAAAGAAGCCAGACACAAAAGGG + Intergenic
1154043450 18:10881893-10881915 GCAAGAAGTGAGATTGAAGATGG - Intronic
1154088491 18:11332268-11332290 GAAAGAAGTCAAATAATAGATGG - Intergenic
1154381402 18:13853604-13853626 GGAAGGAGTAAGATGCAAGATGG + Intergenic
1155944438 18:31832277-31832299 AAAAACAATCAGATTCAAGAAGG + Intronic
1156103843 18:33632963-33632985 GATAGGAATCAGATTCCAGAGGG - Intronic
1156696018 18:39769170-39769192 GAAAGAAGCCAGTCTCCAGAGGG + Intergenic
1157107610 18:44789434-44789456 GAAAGAAGTCAGATTCAAGAGGG - Intronic
1157577767 18:48755039-48755061 GAAACCAGGCAGTTTCAAGACGG + Intronic
1157925406 18:51759765-51759787 GAAAGTTGTCAGAATCAAGATGG - Intergenic
1158168018 18:54563741-54563763 AAAAGAAGTCAGAGCCCAGAGGG - Intergenic
1158232310 18:55271136-55271158 GAAAGAGGTAGAATTCAAGACGG - Intronic
1158257219 18:55565196-55565218 GACAGAAGTCAGACTGAAAAGGG + Intronic
1158406789 18:57166739-57166761 GGAGGAACACAGATTCAAGAAGG + Intergenic
1159403515 18:67969323-67969345 GAAAGAACTGAAATTCAATATGG + Intergenic
1161192465 19:2966063-2966085 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1161289473 19:3485262-3485284 GAAAGTAGGCAGATTTGAGATGG + Intergenic
1161773824 19:6246520-6246542 GAAAGAAACCAGATACAAAAGGG + Intronic
1162521274 19:11181162-11181184 GAAAGAAGCCAGATGCAAAAGGG + Intronic
1163133726 19:15293902-15293924 GAAAGAAGTCAGACACAAAAGGG - Intronic
1164900095 19:31911443-31911465 GAAAGCAGTCTGATTTAATAAGG + Intergenic
1165597478 19:37022494-37022516 GAATGAATTCAAATTCAAAAAGG + Intronic
1166035659 19:40166398-40166420 GAAAGTTGTCAGAGTCAAAATGG + Intergenic
1166288517 19:41847295-41847317 GAAAGAAGCCAGAATCAGGGCGG + Intronic
1166581170 19:43901374-43901396 GAGAGAAGCCAGATTCATGGAGG - Intronic
1167443653 19:49524877-49524899 CAAGGCAGTCAGATTCAAGGAGG - Intronic
1168556755 19:57349815-57349837 GAAAAAAATCACATGCAAGAGGG - Intergenic
926518064 2:13874628-13874650 GATAGAAGGCAAATTCAACAAGG - Intergenic
926527936 2:14006382-14006404 GAAGGAAGCCAGATACAAAAAGG + Intergenic
926550642 2:14296732-14296754 GAAAGAATTAAGAGTCAAGATGG + Intergenic
926656135 2:15408479-15408501 GAAAGTAGTGAGATATAAGAGGG - Intronic
927091178 2:19713897-19713919 GAAAGAGTTCAGATTCAGGCTGG + Intergenic
927163102 2:20288567-20288589 GAAAGACTAAAGATTCAAGACGG + Intronic
927293545 2:21427625-21427647 GCAAGAAGCCAGATTGGAGAGGG - Intergenic
927300879 2:21512786-21512808 GAAAGTTGTCAGAATCAAAATGG + Intergenic
927827461 2:26318588-26318610 GAAAGACATCAGAGTCTAGAGGG - Intronic
927903224 2:26838158-26838180 GAAAGTTGTCAGAATCAAAATGG + Intergenic
928741650 2:34361389-34361411 GAAATAAGGAAGATACAAGATGG - Intergenic
929060616 2:37920965-37920987 GAAAAAAGTCATTTTCAAAAAGG - Intergenic
929327191 2:40629854-40629876 GCAAGATGTCATATTCAAAAAGG - Intergenic
929352674 2:40978014-40978036 GAAAGAAGTCAGATACAAAATGG - Intergenic
929988939 2:46767931-46767953 GGAAGATGACAGTTTCAAGAGGG - Intergenic
930709350 2:54535504-54535526 GAAAGAAGTTAGACACAAAAAGG - Intronic
931156470 2:59637386-59637408 AAAAGAAGTCAGATATAAAAGGG - Intergenic
931282173 2:60804300-60804322 GAAGGAACTAAGATGCAAGAAGG + Intergenic
931331528 2:61290539-61290561 AAAAGAAGCCAGATACAAAATGG + Intronic
931837985 2:66119487-66119509 GAAAGAAGACAGATTTAAAAAGG + Intergenic
932578736 2:72979242-72979264 GAAAGAAACCAGAATCAAGAAGG + Intronic
932661201 2:73654074-73654096 GAAAAAAGTTAAATTCAAGTAGG - Intergenic
933147469 2:78872302-78872324 GAAAGTTGTCAGAATCAAAATGG - Intergenic
933932290 2:87165684-87165706 GAAAGAAGTCTTATACAAAAGGG - Intergenic
935936730 2:108193454-108193476 GAAAGAAGCCAGACACAAAAGGG + Intergenic
936046619 2:109193514-109193536 GAAAGAAGCCAGATATAAAAAGG - Intronic
936360823 2:111799751-111799773 GAAAGAAGTCTTATACAAAAGGG + Intronic
936837424 2:116724823-116724845 GAGAGAAGTTAGATTAAAGTGGG - Intergenic
936914042 2:117621672-117621694 GAAAGAAAACAGATGAAAGAAGG - Intergenic
937488375 2:122339531-122339553 GAAAAAAGACAGATTTAAGAAGG - Intergenic
937524580 2:122752360-122752382 GAAAGAAGCAAGATTCAACATGG + Intergenic
937845262 2:126572629-126572651 TCAAGAAGCCACATTCAAGACGG - Intergenic
938714431 2:134006630-134006652 GAAAGTTGTCAGAATCAAAATGG + Intergenic
939287928 2:140156619-140156641 GGAAGAAGTCAGAGTGGAGAGGG - Intergenic
939562122 2:143744448-143744470 GCAAGAATTCAGATTCAACAAGG + Intronic
939611301 2:144314274-144314296 AAAAGAAGTCAGATACAAAAGGG + Intronic
940288086 2:152051968-152051990 GAAAGAAGCCAGATACAAGAGGG - Intronic
940579742 2:155563146-155563168 GAAAGTATTCAGATACAATATGG - Intergenic
941190665 2:162377744-162377766 GAAAGTAGTCAAAATCAAAATGG - Intronic
941580268 2:167288499-167288521 GGAAGAAGTGAGAGGCAAGAAGG - Intergenic
941667158 2:168253659-168253681 GAAAGTTGTCAGAATCAAAATGG - Intergenic
941947030 2:171110599-171110621 AAAAGAAGCCAGACTCAAAAAGG + Intronic
942291249 2:174473776-174473798 GACAGAAGTCAGATCACAGAGGG + Intronic
942542104 2:177025221-177025243 AACAGATGTCATATTCAAGATGG - Intergenic
942857812 2:180571925-180571947 GAAAGAAGCCAGATGCAAAAAGG + Intergenic
943288409 2:186035217-186035239 GAAAGTTGTCAGAATCAAAATGG - Intergenic
943370332 2:187008332-187008354 TAGAGAAGTCAAAGTCAAGAGGG + Intergenic
943821174 2:192323545-192323567 GAAAGAAGTCAGATTTTTAAAGG + Intergenic
943928081 2:193813764-193813786 GAAAGAAATGAGATTCCAAAAGG + Intergenic
944175087 2:196820105-196820127 GAAATAATTCATATTCAATATGG + Intergenic
944177687 2:196851116-196851138 GAAAGTTGTCAGAATCAAAATGG + Intronic
944426027 2:199584193-199584215 GAGATCAGTCAGATTCAATAAGG + Intergenic
944795365 2:203178641-203178663 GAAATAAGCCAGATACAAAAGGG + Intronic
945204451 2:207317117-207317139 GAAAGTTGTCAGAGTCAAAATGG - Intergenic
946184434 2:217971333-217971355 GAAAGAAGCCAGACACAAAAAGG - Intronic
946272680 2:218607567-218607589 GAAAGGAGCCAGATTAAATAAGG + Intergenic
946456527 2:219831019-219831041 CAAAGAAGGCAGCTCCAAGAGGG - Intergenic
946579732 2:221115362-221115384 GAAGGAAGTAAGACTCAAAATGG + Intergenic
946654340 2:221929624-221929646 GAAAGAAACCAGACACAAGAGGG + Intergenic
946657887 2:221968234-221968256 GAAAGTTGTCAGAATCAAAATGG - Intergenic
947523259 2:230864359-230864381 GAATGAAGGCAGAAGCAAGATGG + Intergenic
947735477 2:232452338-232452360 GAAAGTTGTCAGAATCAAAATGG + Intergenic
948084455 2:235235613-235235635 GAAAGTTGTCAGAATCAAAATGG + Intergenic
948645875 2:239404166-239404188 AAAAGATGTCAGATACAAAAGGG + Intergenic
948970855 2:241425485-241425507 GAAAGAAGTGTGATTTAAAATGG + Intronic
1169118359 20:3081593-3081615 GAAAGGCCTCAGGTTCAAGAAGG + Intergenic
1169467717 20:5856295-5856317 GAAAGAAGCCAGATTTATGAAGG + Intronic
1169561881 20:6810411-6810433 GAAAGAAATCAGAGGCAAAAGGG + Intergenic
1169959490 20:11143170-11143192 GAAAAAAGGGAGCTTCAAGAAGG + Intergenic
1170446386 20:16432184-16432206 GAAAGCAGACAAATTCCAGAAGG + Intronic
1170606543 20:17878906-17878928 GAAAGAAGCCAGAATTCAGAAGG + Intergenic
1171293996 20:24000874-24000896 CAAAGAAGTAAAATTCAAGGAGG + Intergenic
1171354815 20:24535872-24535894 GAAAGTTGTCAGAATCAAAATGG - Intronic
1172018605 20:31896316-31896338 GAAAGTTGTCAGATTCAAAATGG - Intronic
1172430461 20:34886754-34886776 GAAAGAAGTGAGCTCCAAGAGGG - Intronic
1173518334 20:43681049-43681071 GAAAGAAGCCAGACACAGGAGGG - Intronic
1174110722 20:48196051-48196073 AAAAGGGGTCAGATACAAGAAGG - Intergenic
1174118459 20:48244146-48244168 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1174195252 20:48768402-48768424 GAAAGAAGCCAGACACAAAAGGG + Intronic
1176744416 21:10639041-10639063 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1178064565 21:28889812-28889834 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1178119741 21:29456922-29456944 GAAAGAACTCAGAAAGAAGAAGG - Intronic
1178684940 21:34703329-34703351 GAAAGATGGTAGAATCAAGAAGG + Intronic
1178691200 21:34751681-34751703 GAAAGAAGTCACAATCATGGTGG - Intergenic
1179529711 21:42010342-42010364 GGATGACGTCAAATTCAAGATGG - Exonic
1179649416 21:42797342-42797364 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1179837233 21:44044271-44044293 GAAAAAAGTCTCATTCAAAATGG - Intronic
1181383956 22:22529789-22529811 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1181626774 22:24127477-24127499 GGAAGTAGTCTGATTCTAGATGG + Intronic
1181935043 22:26432261-26432283 GAGAGAAGCCAGATTAGAGATGG - Intronic
1182228550 22:28819071-28819093 GAAATAAGTCAGCTTTAGGAAGG + Intergenic
1182788499 22:32928584-32928606 GAAAAAAGGCAGATTACAGATGG - Intronic
1182843156 22:33408555-33408577 GAAAGTTGTCAGGATCAAGATGG - Intronic
1182847021 22:33439661-33439683 GAAAGAAGTCTGAGTTAACATGG - Intronic
1182910213 22:33977969-33977991 GAAAGAAGTCCCGTTGAAGATGG + Intergenic
1184803991 22:46780606-46780628 GAGACAAGTCAGAGTCAAGAGGG - Intronic
1185105184 22:48864942-48864964 GGAAGAAGGCAGATTCAGGATGG - Intergenic
949253001 3:2010128-2010150 GAGAGAAGGCAGATGCAATAGGG + Intergenic
949394751 3:3602817-3602839 GAAAGAAATCAAAGTCAAAATGG + Intergenic
949528147 3:4926896-4926918 GAAAGAAGTCAGTCACAAAAGGG + Intergenic
949549808 3:5103541-5103563 GAAAGTGGTCAGAATCAAAATGG - Intergenic
949817637 3:8076871-8076893 GAAAGAAGTGAAACTCAAGCAGG + Intergenic
949989700 3:9569014-9569036 GAAAGAAGCCAGATTCAAGAGGG - Intergenic
950075091 3:10181272-10181294 GAAAGTTGTCAGAATCAATATGG + Intronic
950607318 3:14094251-14094273 GAAAGAGGTCATATTTGAGAAGG + Intergenic
951448375 3:22808523-22808545 GAAATAAGTCAGATACAAAAGGG + Intergenic
951630500 3:24714923-24714945 CAAAGAAGTCAATCTCAAGATGG - Intergenic
951782326 3:26377656-26377678 GAAAGAAACCAGATGCAAAATGG + Intergenic
952015900 3:28957351-28957373 GAAAGAAGCCAGACACAAAAAGG - Intergenic
952089401 3:29865936-29865958 GAAGGAAGTGAGATTCAGAATGG - Intronic
952091779 3:29895502-29895524 GGAAGACGTCAGACTCAAAAGGG - Intronic
952456005 3:33472394-33472416 GAAAGTTGTCAGAATCAAAATGG - Intergenic
952466926 3:33598730-33598752 GACAGAAGTCAGATTTTAGTTGG - Intronic
953080467 3:39611934-39611956 GAAAGAGCTCAGATTCTAAAGGG + Intergenic
953146900 3:40285942-40285964 GAAAGTTGTCAGAATCAAAATGG + Intergenic
953366033 3:42346067-42346089 GAAACCAGCCAGAATCAAGATGG + Intergenic
954900332 3:54013914-54013936 GAGAGATGTCAGCTCCAAGAAGG + Intergenic
955754952 3:62217272-62217294 GTAAGAAGACAGAGTCAAGTAGG - Intronic
955954258 3:64272372-64272394 GAAAGAATTCAGCGTCAAGCAGG + Intronic
956484920 3:69711908-69711930 GAAAGAATTCAGGTGCAAGCCGG - Intergenic
956587414 3:70879180-70879202 GAGAGAAGTGAGAGTGAAGAGGG - Intergenic
956865827 3:73367608-73367630 GACAGAGGTCAGTCTCAAGAAGG - Intergenic
957466849 3:80604217-80604239 GAAAGAAGTCCGTTTAAATATGG - Intergenic
957501301 3:81061035-81061057 GAAAGTTGTCAGAATCAAGATGG + Intergenic
957922360 3:86762255-86762277 GAAAGAAGTCTGATTAATCATGG - Intergenic
957991139 3:87628614-87628636 GAAAGAACTCAGATTCAGATAGG - Intergenic
958045258 3:88276789-88276811 GAAAGTTGTCAGATTCAAAATGG - Intergenic
958675392 3:97263993-97264015 GAAAAAAGTTAGATTCTAGGGGG - Intronic
959277293 3:104292695-104292717 GAAAGCTGTCAGATTCAAAATGG - Intergenic
959349142 3:105238697-105238719 GAAAGACATCAGAATCAAAATGG - Intergenic
959563008 3:107803843-107803865 GAAAGAAGTCAGAATCACAGTGG - Intronic
960073157 3:113454396-113454418 GAAAGCTGTCAGAATCAAAATGG + Intronic
960138366 3:114128516-114128538 GAATGAAGTCAGATTTTAGCTGG + Intergenic
960365512 3:116766835-116766857 CAAAGAAATCAGATAGAAGATGG - Intronic
960777826 3:121280395-121280417 GAAAGGAGTCAGCTACAATATGG - Intronic
960848181 3:122023654-122023676 AAGAGAAGTCAGATCCAGGAGGG - Intergenic
960914811 3:122684307-122684329 GGAAGAAGTGAGTTTCAAGGAGG - Intronic
961400785 3:126640832-126640854 GAAAGTTGTCAGAATCAAAATGG + Intronic
962323347 3:134409289-134409311 GAAAGATGTGAGACTAAAGATGG + Intergenic
962402479 3:135072479-135072501 GAACGGAGTCAGGTTCCAGAGGG - Intronic
963538541 3:146558866-146558888 GAAAGTTGTCAGAATCAAAATGG + Intergenic
963916808 3:150866329-150866351 AAACCAAATCAGATTCAAGATGG - Intergenic
964306920 3:155351396-155351418 GAAAGAAGTCAAATTCTGGCTGG - Intergenic
964370574 3:155995968-155995990 GAAAGAAGTCATATTCTAGAAGG + Intergenic
964437405 3:156668889-156668911 GAAAAAAGTGAGTTTCAAGAGGG + Intergenic
964856856 3:161155340-161155362 GATAGAATTCAAATTTAAGAGGG + Intronic
964871376 3:161316978-161317000 GAAAGCTGTCAGACTCAAAATGG + Intergenic
965169453 3:165242986-165243008 GAAAGTTGTCAGAATCAAAAGGG - Intergenic
966685787 3:182693048-182693070 GAAAGTTGTCAGAATCAAAATGG - Intergenic
967509326 3:190291629-190291651 GAAAGATGTAATATTTAAGAGGG - Intergenic
967537558 3:190624506-190624528 GAAAGCTGTCAGAGTCAAAATGG - Intronic
968686419 4:1962240-1962262 CAAAGAAGTCAGTGTCATGAAGG + Intronic
968888564 4:3352866-3352888 GAAAGTTGTCAGGTTCAAAACGG - Intronic
969677504 4:8622130-8622152 GAAAGCTGTCAGAATCAAAATGG + Intergenic
969678459 4:8627771-8627793 GAAAGCTGTCAGAATCAAAATGG + Intergenic
969679415 4:8633405-8633427 GAAAGCTGTCAGAATCAAAATGG + Intergenic
970734763 4:19152791-19152813 GAATGAAGTCATATTCCAGCTGG - Intergenic
970768310 4:19578379-19578401 CAAAGATGTCAGCTTCAAGGAGG + Intergenic
970778440 4:19705769-19705791 AAAAGAAGTCAGTCTGAAGAAGG - Intergenic
970886138 4:20989491-20989513 AAAAGAAGTAAAATTCTAGAAGG + Intronic
971054787 4:22899696-22899718 GCAAGAAGACAGATTCCTGAGGG - Intergenic
972225111 4:37003410-37003432 GAAATAAGCCAGATACAAAAAGG - Intergenic
972708899 4:41574200-41574222 GATATAAGTCAAAATCAAGATGG - Intronic
973536220 4:51885047-51885069 GAAAGATGTAAGACTGAAGAGGG + Intronic
973577487 4:52305228-52305250 GAAAGAGATAAGATTAAAGAAGG - Intergenic
973837875 4:54828941-54828963 GAAAGAAATCATATTCAAGTAGG + Intergenic
973989708 4:56391648-56391670 GAAAGTTGTCAGATTCAAAATGG - Intergenic
974361653 4:60888702-60888724 CAAAGAAGTATGATACAAGAAGG + Intergenic
975213073 4:71723331-71723353 GAATGAAGGCTGGTTCAAGACGG - Intergenic
975241999 4:72070707-72070729 GAAAGTTGTCAGAATCAAAATGG - Intronic
975303544 4:72820697-72820719 GAAAGTAGATAGATCCAAGAAGG + Intergenic
975553198 4:75633983-75634005 GAAAGAAGCCAGACACAAAAAGG + Intergenic
975767608 4:77685428-77685450 GAAAGAAGCCAGATCAAAAAAGG + Intergenic
976287939 4:83388137-83388159 GAAAGATGTCAGAGTCAAAATGG - Intergenic
976561569 4:86507749-86507771 GAAAGTTGTCAGAATCAAAATGG + Intronic
976562162 4:86514095-86514117 GAAAGTTGTCAGAATCAAAATGG + Intronic
976735702 4:88306857-88306879 GAAAGTTGTCAGAATCAAAATGG - Intergenic
976857435 4:89621711-89621733 GAAAGTTGTCAGAATCAAAATGG - Intergenic
976906122 4:90238596-90238618 GAAAAAAGTCACATTCAACCAGG - Intronic
977811060 4:101356538-101356560 GTAATAGGTCAGATTCAACAGGG + Intergenic
979397353 4:120204196-120204218 GGAAGAAGACAGAATCAAGGGGG - Intergenic
979418670 4:120476302-120476324 GAAGGAAGACAGATAGAAGAAGG + Intergenic
979943419 4:126792764-126792786 GAAAAAAGTTGGATTCAAGTGGG - Intergenic
980181389 4:129405929-129405951 CAAATAAGTCAGTTTCTAGATGG - Intergenic
980296939 4:130932197-130932219 GAAAGAAGCAAGATTAAAAATGG + Intergenic
980411759 4:132429318-132429340 GAAAAAATTCAGAATCTAGATGG - Intergenic
980419741 4:132544461-132544483 TAAAGAAGTTGTATTCAAGATGG + Intergenic
980537420 4:134146669-134146691 GAAAGCTCTCAGAATCAAGAGGG + Intergenic
980608598 4:135126320-135126342 GAAGGAAGAAAGTTTCAAGAAGG - Intergenic
981133856 4:141188858-141188880 GACAGAAGTTGGCTTCAAGAAGG - Intronic
982886259 4:160786796-160786818 GAAAGAATTCAGATTCAGCCAGG - Intergenic
984982253 4:185293478-185293500 GAAAGAAGCCAGATGCAATAGGG + Intronic
985144514 4:186880996-186881018 GAAAGAAGGCAGAGTGGAGAGGG + Intergenic
985146578 4:186900181-186900203 GAAAGAAGTGGGCTTGAAGATGG + Intergenic
985327825 4:188792731-188792753 AAATGAAGGCAGATTCTAGAAGG + Intergenic
985697666 5:1350152-1350174 GAAAGTTGTCAGAATCAAAATGG + Intergenic
985842003 5:2313674-2313696 GAAAGCTGTCAGAGTCAAAATGG + Intergenic
986101341 5:4614432-4614454 GAAAGTTGTCAGATTCAAAATGG - Intergenic
986306197 5:6518858-6518880 GAAAGTTGTCAGATTCAAAATGG - Intergenic
986342718 5:6804882-6804904 GAAAAAAGTCAGATGTATGAGGG + Intergenic
986423033 5:7603162-7603184 GAATGAAGTCAGCCTCAGGAAGG - Intronic
986444042 5:7805827-7805849 GATAGACGTCTGACTCAAGATGG + Intronic
987277493 5:16377041-16377063 GAAAGTGGTCAGAATAAAGAAGG - Intergenic
987856046 5:23422243-23422265 GAATGAAGTGCGATTTAAGATGG + Intergenic
988284531 5:29194239-29194261 GAAAGTTGTCAGAATCAAAATGG - Intergenic
988532386 5:32039040-32039062 GAAAGATGGCAGGTTTAAGACGG + Intronic
988696774 5:33629470-33629492 GAAAGTTGTCAGAATCAAAATGG + Intronic
988877601 5:35464766-35464788 GAAAGTTGTCAGAATCAAAATGG + Intergenic
988921597 5:35947369-35947391 GAAAGTTGTCAGAATCAAAATGG - Intergenic
989371782 5:40718127-40718149 TAAAGAAGACAGATACATGATGG + Intronic
989743332 5:44797914-44797936 GAAACCAGCCAGAATCAAGATGG + Intergenic
989952303 5:50313971-50313993 AAAAGAAATCAGAATAAAGAGGG + Intergenic
990601267 5:57360786-57360808 GGAAGAAGGCAGACTCTAGAAGG + Intergenic
991145864 5:63302858-63302880 AGAAGAAGTCAGATTCTACATGG - Intergenic
991235000 5:64383951-64383973 GAAAGCAACCAGATTCTAGAAGG + Intergenic
991540847 5:67726546-67726568 GAAAGAAGATAGACTCTAGATGG + Intergenic
992003257 5:72455267-72455289 GAAAGAAGTCAGCTTCACAGGGG + Intronic
992290778 5:75277309-75277331 GAAACAAGTCACACTCAAGGAGG - Intergenic
992326525 5:75665502-75665524 AAAAGAAGTAAGATTGAGGATGG - Intronic
993028716 5:82677565-82677587 GAAAGGACTCAGATTCAAGAAGG + Intergenic
993083122 5:83327299-83327321 GAAAGAAGCCAGACTCAAGATGG - Intronic
993423944 5:87738705-87738727 GGAAAAAGTCAGATTCAAGTAGG + Intergenic
993492826 5:88572524-88572546 GAAAGAGGTCAGACTGAGGAAGG - Intergenic
993667491 5:90718240-90718262 GAAGGAAGTCAGACACAAAAGGG - Intronic
994135028 5:96276497-96276519 AAAAGAACTGAGATTGAAGATGG + Intergenic
994414068 5:99445535-99445557 GAAAGAAGTAAGATTCCTGCTGG + Intergenic
994545575 5:101162848-101162870 GAGAGGAGTCCGTTTCAAGATGG + Intergenic
995941185 5:117586600-117586622 GATAAAAGACGGATTCAAGAAGG - Intergenic
996078939 5:119232927-119232949 GAAAAAAATCAGATTAAAGAAGG - Intronic
997552378 5:134764688-134764710 GTAATAAGTTATATTCAAGAGGG + Intronic
998775967 5:145602786-145602808 GAAAAAAATCAGAATCAAGCAGG + Intronic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
1000701700 5:164458822-164458844 GGAAGAAATCATATTCAGGAGGG - Intergenic
1001814442 5:174656286-174656308 GAAAGAAATCAAAGCCAAGAAGG + Intergenic
1001968198 5:175929817-175929839 GAAAGAAATCAGTTTGAAAAAGG + Intronic
1002249247 5:177913993-177914015 GAAAGAAATCAGTTTGAAAAAGG - Intergenic
1003623259 6:7720946-7720968 GAAAGAATTCAGAATTAAGACGG + Intergenic
1004231431 6:13837164-13837186 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1004769878 6:18769868-18769890 GAAAGAAGCCTGATTCAAGAAGG + Intergenic
1005451325 6:25975653-25975675 TAGAGAAGTCAGATTGGAGACGG - Intronic
1005795446 6:29356088-29356110 GAAATAAGTCAGAAAGAAGATGG + Exonic
1007070427 6:39033539-39033561 GAAAGAAGTCAGACCAAAAAAGG + Intergenic
1007854770 6:44844622-44844644 AAAAGAAGTCAGACTCAAAGGGG + Intronic
1008154052 6:47991483-47991505 GAAAGAAGACTGATCCCAGATGG + Intronic
1008291989 6:49726933-49726955 GAATGAAGTGAGATTGGAGAGGG + Intergenic
1008714219 6:54268766-54268788 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1008912908 6:56756042-56756064 GAAAGACGACGGAGTCAAGAGGG + Intronic
1009552102 6:65111128-65111150 AAAAGAAGACATTTTCAAGATGG + Intronic
1010257963 6:73781837-73781859 GGAAGAACTCAGATTGATGAGGG - Intronic
1011457687 6:87569717-87569739 GAAGGAAGCCAGATTCAAAAAGG + Intronic
1011591657 6:88975800-88975822 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1011651830 6:89513476-89513498 AAAAGAGGTCAGATACAAAAAGG - Intronic
1011717037 6:90117295-90117317 AAAAGAATTGAAATTCAAGATGG - Intronic
1012384436 6:98662533-98662555 GAAATAAGTTACAATCAAGAAGG - Intergenic
1012587685 6:100944445-100944467 TAAAGAATTCAGAATCATGAAGG - Intergenic
1013814520 6:114082073-114082095 GAAAGAGCTGAGATGCAAGAAGG - Intronic
1013822978 6:114177529-114177551 GAAATAAGGCACATTTAAGAAGG - Intronic
1014445559 6:121523377-121523399 GAAAGATGTCAGAAGCAAGCAGG + Intergenic
1015562312 6:134529731-134529753 GAAAGAAGAAAGATAAAAGAGGG + Intergenic
1015618251 6:135101922-135101944 GAAATAAGCCAGATGCAAAAGGG - Intronic
1015861804 6:137689270-137689292 GAATGAAGAGAGAATCAAGATGG - Intergenic
1016671169 6:146709834-146709856 GAAATAAGACACATTGAAGAAGG - Intronic
1016834515 6:148463915-148463937 TAAACAAGACAGATTCAAGAAGG - Intronic
1016930212 6:149398859-149398881 GAAAGAAGTCAAATTAATGCTGG - Intronic
1017202801 6:151774050-151774072 GGAAGAAGTTAGATTAAACAGGG + Intronic
1017598813 6:156059156-156059178 GTAAGAAGTGAGATGCAGGAAGG - Intergenic
1018200248 6:161387840-161387862 GACACCAGTCAGATTGAAGAAGG - Intronic
1018565655 6:165148923-165148945 GAAAGAAGAAAGTTTAAAGAAGG - Intergenic
1018764388 6:166921635-166921657 GAAAGTTGTCAGAATCAAAATGG + Intronic
1018920646 6:168170072-168170094 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1020341880 7:7120300-7120322 TAAAGAATTCTGATTCAAGATGG - Intergenic
1020523363 7:9223840-9223862 GAAAGAAATCAAATTTAAAATGG - Intergenic
1021069885 7:16223289-16223311 GAAATAAGTCAGTTTGTAGATGG - Intronic
1021610560 7:22453818-22453840 GAAAGAAGCCAGATACAAAAGGG - Intronic
1021802653 7:24323240-24323262 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1021869285 7:24987627-24987649 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1022131713 7:27410903-27410925 GAAAGAAGTCAGATACGAAAAGG + Intergenic
1022455607 7:30555762-30555784 GAAATAAGCCAGACTCAAAAGGG - Intergenic
1022783492 7:33611040-33611062 GCAAGCTGTCAGATTGAAGAGGG + Intergenic
1022797140 7:33741161-33741183 GAAAGAAGCCAGATATAAAAGGG - Intergenic
1024208073 7:47180784-47180806 GAAGGAAGTGAGATGCTAGAAGG + Intergenic
1024470236 7:49761972-49761994 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1025938400 7:66055670-66055692 GAAAATAGGGAGATTCAAGAGGG - Intergenic
1026069304 7:67103880-67103902 GAAAGAAGAGAGAAACAAGAAGG + Intronic
1027470540 7:78568265-78568287 GAAAGCTGTTAGATTCTAGATGG - Intronic
1027781392 7:82524825-82524847 GTGAGGAGTCAGATCCAAGAAGG + Intergenic
1027863666 7:83618118-83618140 GAAAGAAGTCAGAGTAAGAAAGG + Intronic
1030237951 7:107287449-107287471 GAAAGTTGTCAGATTCGACATGG - Intronic
1030521948 7:110608428-110608450 GAAAGACCACATATTCAAGAGGG - Intergenic
1031613972 7:123858947-123858969 GAAAGCAATCAGATTTGAGAAGG + Intronic
1032284322 7:130529388-130529410 GCATGATGTCAGACTCAAGATGG + Intronic
1032857190 7:135844809-135844831 CTAAGAACTCAGATTGAAGAAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033527136 7:142227431-142227453 GAAAGTTGTAAGATTCAAAATGG + Intergenic
1035148975 7:156850545-156850567 GAAAGAAGCCAGACACAAAAAGG - Intronic
1035531460 8:355076-355098 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1036047379 8:5159064-5159086 GAACGAAGTTAGGTTCAAGCTGG - Intergenic
1037078162 8:14748272-14748294 GAAAGAATTCAGACCCAAGTTGG + Intronic
1037150487 8:15629205-15629227 GAAAAAAGTGAGATTATAGAGGG + Intronic
1037274428 8:17162544-17162566 GAAAGAAGGCAGCTTCTTGAGGG + Intronic
1037550684 8:19968589-19968611 GAAAGAAACCAGATGCAAAATGG + Intergenic
1038544916 8:28418374-28418396 GAAATAAGCCAGATACAAAAAGG - Intronic
1039675051 8:39654073-39654095 GAAATAAGTCAGACACAAGAAGG - Intronic
1039704208 8:39990342-39990364 GAAAGTTGTCAGAATCAAAATGG + Intronic
1039877626 8:41600857-41600879 GAAAGAAGCCAGACACAAAAGGG - Intronic
1040935866 8:52781399-52781421 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1041002971 8:53469756-53469778 GAAAGCTGTCAGAATCAAGATGG + Intergenic
1041003550 8:53476902-53476924 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1041076738 8:54175993-54176015 GAAACAGGTCAAAATCAAGATGG + Intergenic
1042071172 8:64936117-64936139 GAAAAAAGCCAGATACAAAAAGG - Intergenic
1042124386 8:65522899-65522921 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1042977100 8:74481538-74481560 CAAAGAAGTGAGATAGAAGAAGG - Intronic
1043326555 8:79059447-79059469 GCAAGAAGACAAATTCAAGGAGG + Intergenic
1043837326 8:85062729-85062751 GAAACCAGTCAGAATCAAGATGG - Intergenic
1044298788 8:90559024-90559046 CAAAGAAATCAGATGCACGAAGG + Intergenic
1044548084 8:93481754-93481776 GAAAGAAATAGCATTCAAGAGGG - Intergenic
1044837906 8:96313866-96313888 GAAAGAGGACAGTTTCAAGAAGG - Intronic
1045089252 8:98722882-98722904 GTAAGAATTCAGCTCCAAGATGG + Intronic
1045635683 8:104186121-104186143 GAAAAAAGTCAGATGCAGAAAGG + Intronic
1045795735 8:106041397-106041419 GAAAGAAGCCAGATTAAAAAAGG - Intergenic
1045953328 8:107876912-107876934 GATAGAAGCCAAAATCAAGATGG - Intergenic
1046112386 8:109740894-109740916 GAAAAAAGTCAGACTTAAGCTGG - Intergenic
1046288125 8:112122390-112122412 GAAATAAGCCAGGTACAAGAAGG - Intergenic
1046319497 8:112553651-112553673 GAAAGTTGTCAGAATCAAAATGG - Intronic
1046333056 8:112747402-112747424 GAAAGAAGTGAGAATAAATATGG + Intronic
1046418280 8:113943884-113943906 GAAAGAAGTGACATTTAAGATGG + Intergenic
1046464096 8:114580187-114580209 GTAAGAAGTGAGATATAAGAAGG - Intergenic
1047080504 8:121454503-121454525 GAAAGGAGACAAAATCAAGACGG + Intergenic
1047146990 8:122213251-122213273 GAAAGACGACAGATACAAAATGG + Intergenic
1047223078 8:122934541-122934563 GAGAAAAGCCAGAATCAAGAAGG - Intronic
1048217579 8:132510468-132510490 GAAAGTATTCAGTTTCAAAAGGG - Intergenic
1048302707 8:133263216-133263238 GGAAGAAGTGAGATAAAAGAAGG + Intronic
1048310147 8:133315810-133315832 GAAAGTTGTCAGAATCAAAATGG + Intergenic
1048387239 8:133923277-133923299 GACAGAGATCAAATTCAAGATGG - Intergenic
1049247105 8:141568766-141568788 GACAGAATGCTGATTCAAGAAGG + Intergenic
1049524916 8:143119480-143119502 GAAAGCAGCCAGAGACAAGATGG + Intergenic
1050461651 9:5882404-5882426 GAAAGTAGTCAGAATCAAAATGG + Intronic
1050741844 9:8829390-8829412 GAAAGAAGCCAGAAACAAAAGGG - Intronic
1051215224 9:14790646-14790668 AATAAAAGTCAGATTCAAGATGG + Intronic
1051436417 9:17037811-17037833 GTAAGAAGTCATCTTCCAGAAGG - Intergenic
1053032234 9:34790454-34790476 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1053552141 9:39093625-39093647 GAAATAAGCCAGACCCAAGAGGG - Intronic
1053816272 9:41913772-41913794 GAAATAAGCCAGACCCAAGAGGG - Intronic
1054106532 9:61057456-61057478 GAAATAAGCCAGACCCAAGAGGG - Intergenic
1054614325 9:67273669-67273691 GAAATAAGCCAGACCCAAGAGGG + Intergenic
1054802197 9:69361392-69361414 GAAAGAAGCCAGACACAAAAGGG - Intronic
1054868089 9:70023757-70023779 GAAATAAGTTAGATGCAAAAGGG - Intergenic
1055074494 9:72199764-72199786 TAAAGAAGAGACATTCAAGAAGG - Intronic
1056081443 9:83098463-83098485 GAAAGTAGTCATAATCATGAGGG - Intergenic
1056197618 9:84243699-84243721 GAGAGAAGTCCGATACAAGGAGG - Intergenic
1057246097 9:93455267-93455289 GAAAGAAGCCAGGTTCAAAAGGG + Intronic
1057626623 9:96683698-96683720 GAAAGTTGTCAAATTCAAAATGG - Intergenic
1058162509 9:101585075-101585097 GACAAAAGTCTGATTGAAGAGGG - Intronic
1058279890 9:103101132-103101154 AAAAGAAGCCAGAATCAAGGAGG + Intergenic
1058298088 9:103334029-103334051 GAAAGAAGTCAATTTCAACAGGG - Intergenic
1058306101 9:103442502-103442524 AAAAGAAGTCAAATATAAGAAGG + Intergenic
1058408127 9:104700232-104700254 AAAAGCAGACAGATTCAGGATGG + Intergenic
1058444730 9:105044785-105044807 GAAAGAATTCAAATTCAAATGGG - Intergenic
1058758110 9:108102561-108102583 CCAAGAAGTCAGATACAATAAGG + Intergenic
1058873763 9:109224424-109224446 GAAAGAAGCCAGACACAAAAAGG + Intronic
1059551096 9:115229966-115229988 GAAAGAAGCCAGATACAAACAGG - Intronic
1060750726 9:126166702-126166724 AAAAGAAGCCAGATTTAAGCAGG + Intergenic
1061515642 9:131088408-131088430 GAAGGAGGTCAGATTCAAGATGG + Intronic
1061736582 9:132664758-132664780 GCCAGAGGTCAGATTCTAGAAGG - Intronic
1061998491 9:134202998-134203020 AAAAGAAGCCAGACTCAAAAAGG + Intergenic
1062184400 9:135209863-135209885 GAAAATCGTCAGAATCAAGATGG + Intergenic
1186227509 X:7416702-7416724 AAAAGAAGCCAGACTCAAGAGGG - Intergenic
1186319429 X:8408016-8408038 GAAAGATGTCAGATTCCCTATGG - Intergenic
1186746989 X:12580095-12580117 AAAAGCAGTTAGATTCAAGAGGG + Intronic
1186804888 X:13130684-13130706 GACAGAATTCAGAAGCAAGAAGG + Intergenic
1187134689 X:16535565-16535587 GAATGAAGTAAGATGCAAGAAGG - Intergenic
1187857950 X:23655140-23655162 GAAAGAAGTGATATTGAGGATGG - Intergenic
1189022509 X:37355656-37355678 GAAAAAAGTAAGTTTAAAGATGG + Intronic
1189266745 X:39722594-39722616 GAAAGAAATCAGAATCTAAAAGG - Intergenic
1189481179 X:41393458-41393480 GAAAGAAGCCAGACACAAAAGGG + Intergenic
1189538892 X:41965800-41965822 GAAATAAGCCAGATGCAAGAGGG + Intergenic
1189731421 X:44024942-44024964 GAAAGAAGTTAGAGGAAAGAGGG - Intergenic
1190167298 X:48083716-48083738 GGAAGAATTCAGATTAAAGGTGG + Intergenic
1190782479 X:53611377-53611399 CAAAGAAGCTAGATACAAGAAGG + Intronic
1192225642 X:69226090-69226112 GAAAGAAGCCAGATACAAAAGGG + Intergenic
1193047072 X:77064767-77064789 GATAAAGGTCAGATTCAAGGTGG + Intergenic
1193798029 X:85900249-85900271 GAAAGAAGCCAGACACAAAAAGG + Intronic
1193831835 X:86297553-86297575 GAAAGCAGTCAGATTGTATAAGG + Intronic
1196402757 X:115333251-115333273 GAAAGAAGTCAGGAACAAAAGGG - Intergenic
1196477776 X:116108754-116108776 GAAAGAAGAAAGAAGCAAGAAGG - Intergenic
1196490334 X:116257946-116257968 GAAAGAATTAACATACAAGATGG - Intergenic
1196549896 X:117011469-117011491 GAAAAAAGTCACATTCAAAATGG + Intergenic
1196560580 X:117143062-117143084 GAAAGAAGCCAGACACAAAAAGG + Intergenic
1196798251 X:119519767-119519789 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1197463083 X:126767532-126767554 GAAAGTGGACAGATTCCAGAAGG - Intergenic
1198060716 X:133043113-133043135 GAAAGTAGTCAAATTGAAGGGGG + Intronic
1198706167 X:139450795-139450817 ATAAAAAGTCAGATTCTAGAAGG + Intergenic
1199963738 X:152800941-152800963 GAAAGTTGTCAGAATCAAAATGG - Intergenic
1200002722 X:153070502-153070524 GAAAGGTTTCAGAATCAAGATGG - Intergenic
1200005001 X:153079507-153079529 GAAAGGTTTCAGAATCAAGATGG + Intergenic
1200423687 Y:2999397-2999419 GAAAGCTGTCAGATTAAAAATGG + Intergenic
1201504070 Y:14678523-14678545 GAAAGAAGTGGAAATCAAGACGG + Intronic
1202057562 Y:20850894-20850916 GAGAGAAGGGAGAATCAAGATGG - Intergenic