ID: 1157108350

View in Genome Browser
Species Human (GRCh38)
Location 18:44796024-44796046
Sequence GATTAGAAGCACAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157108350_1157108355 10 Left 1157108350 18:44796024-44796046 CCTTCCAATTTGTGCTTCTAATC 0: 1
1: 0
2: 0
3: 21
4: 250
Right 1157108355 18:44796057-44796079 GGGATACGACATAATCAAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 33
1157108350_1157108354 -10 Left 1157108350 18:44796024-44796046 CCTTCCAATTTGTGCTTCTAATC 0: 1
1: 0
2: 0
3: 21
4: 250
Right 1157108354 18:44796037-44796059 GCTTCTAATCTGCTGTGGATGGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157108350 Original CRISPR GATTAGAAGCACAAATTGGA AGG (reversed) Intronic
901984361 1:13062423-13062445 AATTAAAAGCAAAAATTGCAGGG - Intronic
901997449 1:13164347-13164369 AATTAAAAGCAAAAATTGCAGGG + Intergenic
904281619 1:29424476-29424498 GAGTAGAAGCTCAAAATAGATGG - Intergenic
904906914 1:33904339-33904361 GATGAGAAGTCCAAACTGGATGG + Intronic
907842530 1:58171222-58171244 CATTGGAAGGACAATTTGGAAGG + Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908817145 1:68046284-68046306 GAATAGAAAGAAAAATTGGAAGG - Exonic
909354834 1:74696668-74696690 GGTTTGAAGGGCAAATTGGAGGG + Intergenic
909441204 1:75698120-75698142 GCTTGGAAGCTCAAATTGGGTGG + Intergenic
910680561 1:89859843-89859865 TCTTGGAAGCACAAAATGGAAGG - Intronic
911843183 1:102711264-102711286 GATTAAATCCACAAATTGGCTGG + Intergenic
912021478 1:105112612-105112634 CATTAGAAGGACAATTTGGAAGG + Intergenic
912522822 1:110257990-110258012 GATTATAAGTAGAACTTGGATGG - Intronic
912963887 1:114220033-114220055 GGGGAGAAGCACACATTGGAAGG + Intergenic
913469703 1:119175890-119175912 CATTGGAAGGACAATTTGGAAGG + Intergenic
915059989 1:153173484-153173506 GATCAGAAGCACATATTGAATGG + Intergenic
915260751 1:154675081-154675103 CATTGGAAGGACAATTTGGAAGG + Intergenic
916114618 1:161476157-161476179 CATTGGAAGGACAATTTGGAAGG + Intergenic
916161241 1:161917239-161917261 GATAAGAAGGACAAAATGCATGG + Intronic
916939708 1:169665601-169665623 CATTGGAAGGACAATTTGGAAGG + Intronic
918372468 1:183874886-183874908 GATTAGGAGAACAAGGTGGAGGG + Intronic
918589435 1:186223829-186223851 GATTAGAGGCCCAACTTAGAAGG + Intergenic
919509239 1:198440021-198440043 GTTTAGAAGCACAACTGAGAGGG - Intergenic
919594919 1:199549246-199549268 GAATACAAGAGCAAATTGGATGG - Intergenic
921019877 1:211225779-211225801 CATTGGAAGGACAATTTGGAAGG + Intergenic
921668005 1:217895506-217895528 GATTAGAGGCAGATTTTGGAAGG - Intergenic
1062774118 10:131152-131174 GGTTAGAATCACAATTTTGAAGG + Intergenic
1066614395 10:37281060-37281082 CATTGGAAGGACAATTTGGAAGG - Intronic
1068225546 10:54103030-54103052 GATTAACAGCATAAATTGGTGGG + Intronic
1068500495 10:57836271-57836293 CATTGGAAGGACAATTTGGAAGG + Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074302714 10:112247579-112247601 GATTAGAAGGACAATTTAGTAGG - Intergenic
1078822692 11:14897873-14897895 GATAAGAAGCATAAACTGGAGGG - Intergenic
1079241284 11:18723978-18724000 GATTAGAAGCACACGTTGGGTGG + Intronic
1079613972 11:22467785-22467807 GTTTAGAAGCACAAAGTAGAGGG + Intergenic
1079731029 11:23937997-23938019 CATTGGAAGGACAATTTGGAAGG - Intergenic
1080726743 11:34905679-34905701 GATTAGAAGCCCTAGTTGGGGGG + Intronic
1081141500 11:39506547-39506569 GAGTAGAGGCAGAAATTGTAGGG + Intergenic
1081249986 11:40817589-40817611 GAGAAGAAGCAAAATTTGGATGG - Intronic
1081416830 11:42825618-42825640 GATTAGATGCACACATGGCAAGG + Intergenic
1081421617 11:42878551-42878573 CATTGGAAGGACAATTTGGAAGG + Intergenic
1084211203 11:67623613-67623635 CATTGGAAGGACAATTTGGAAGG + Intergenic
1086514591 11:87597053-87597075 TAATGGAAGCAGAAATTGGAGGG + Intergenic
1087075175 11:94121763-94121785 CATTGGAAGGACAATTTGGAAGG + Intergenic
1087292214 11:96332072-96332094 GATTACAACCACACATGGGAAGG - Intronic
1087312883 11:96570410-96570432 AATAAGTACCACAAATTGGATGG + Intergenic
1087882794 11:103438431-103438453 AATTAGAAGCACTATTTGCAAGG + Intronic
1089049535 11:115534224-115534246 GATGGGAAGCACTAATTGAAGGG - Intergenic
1090990020 11:131808743-131808765 GAGAAGCAGCACAAATAGGAGGG + Intronic
1092472506 12:8791850-8791872 AATTAGAAGGACAGTTTGGAAGG + Intergenic
1093345434 12:18034861-18034883 AATTGGAAGGACAATTTGGAAGG + Intergenic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1093580411 12:20779714-20779736 CATTAGAAGGACAATTTGGAAGG - Intergenic
1094487493 12:30936681-30936703 GATTAGAAATACAAGATGGATGG + Intronic
1095792555 12:46183475-46183497 AATTATGAGCACAAATTTGAAGG - Intronic
1097261251 12:57721396-57721418 ACTCAGAAGCACAAATTGTAGGG - Exonic
1098103368 12:67042734-67042756 GATTAGAAGCAGAGACTGAAGGG + Intergenic
1100143118 12:91643168-91643190 TAATTGAAGCACAAAGTGGAGGG - Intergenic
1100829146 12:98502221-98502243 TACTAGAAACACAAATTGAACGG + Intronic
1105557857 13:21463030-21463052 GGTAAGAAGAACAGATTGGAGGG + Intergenic
1105762681 13:23528418-23528440 CATTGGAAGGACAATTTGGAAGG + Intergenic
1109940834 13:69361815-69361837 GATTGGGTGCACAAAGTGGAAGG + Intergenic
1110950920 13:81489651-81489673 GATTAGAAGCATGAATTTCAAGG + Intergenic
1111204393 13:84985541-84985563 GATTGAAAGAACAATTTGGAAGG - Intergenic
1111372714 13:87337070-87337092 CATTGGAAGGACAATTTGGAAGG + Intergenic
1111684915 13:91489864-91489886 AATTAGAAGCATAGATGGGAAGG + Intronic
1112519321 13:100081853-100081875 CATTGGAAGGACAATTTGGAGGG + Intergenic
1112538573 13:100284372-100284394 CATTGGAAGGACAATTTGGAAGG + Intronic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1113339304 13:109406318-109406340 GATTGGAAGCACAAAATTAATGG - Intergenic
1114999983 14:28410552-28410574 GATTTGAAGCACAAAGTAGTTGG - Intergenic
1117129241 14:52668001-52668023 TATTAGAAGCATAAATTAGGGGG + Intronic
1119065864 14:71525795-71525817 GCTTAGAAACACAATTTGGAAGG - Intronic
1120490034 14:85165631-85165653 CATTAGAGGCACAAAATGTATGG + Intergenic
1121850128 14:97214065-97214087 GAGCACAAGCACAAATTGGAAGG - Intergenic
1122357712 14:101133574-101133596 AATTCGAAGGACAAATTGAAGGG + Intergenic
1125593142 15:40867748-40867770 GCTTAGAAGAAAAGATTGGAAGG + Intergenic
1126903806 15:53343040-53343062 GAATAAAAGCAGAAATTGGCTGG - Intergenic
1127708523 15:61571373-61571395 AATTATAAGTACAAATTAGATGG - Intergenic
1129951908 15:79599498-79599520 GATTAGAAGCACAGAGGGGCCGG + Intergenic
1133880547 16:9777707-9777729 GATTAGTCGCACAAGTTGGATGG + Intronic
1135339479 16:21633898-21633920 CATTGGAAGGACAATTTGGAAGG - Intronic
1135845262 16:25912939-25912961 AATCAGAATCACAAAGTGGAGGG + Intronic
1136156673 16:28387626-28387648 GAATAGAAACACAAACAGGAGGG + Intronic
1136206413 16:28727655-28727677 GAATAGAAACACAAATAGGAGGG - Intronic
1139644581 16:68319053-68319075 GGTTAGAATGACAAAGTGGATGG + Intronic
1141574510 16:84955417-84955439 GCTAAGAAGCTCAAATTGGCAGG + Intergenic
1144304687 17:13957502-13957524 GTTTAGAAGCACCTATTGGCTGG + Intergenic
1145375924 17:22348493-22348515 GAATAGAAACACAAAATGTAAGG - Intergenic
1146116350 17:30143320-30143342 GATAAGAAGCAGCATTTGGAAGG + Intronic
1150349436 17:64431287-64431309 GGTTAGAAGCCCAACTTCGAAGG - Intergenic
1151068475 17:71180199-71180221 GATCAGATGCACAACTAGGAAGG + Intergenic
1155104913 18:22654217-22654239 GCTTAAAAGCACAACTTGAAAGG - Intergenic
1155557119 18:27032077-27032099 GGTTAGAAGCACAAACTCTATGG - Intronic
1156082038 18:33347625-33347647 GATATGAATCACAAATTGGCTGG - Intronic
1156947375 18:42851497-42851519 GCATAGAAGCAAAAATTGAAAGG + Intronic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157718179 18:49903733-49903755 GACTTGAAACACGAATTGGAAGG - Intronic
1159289057 18:66392998-66393020 GAAGAGAAGCAGAAATTGCAGGG - Intergenic
1159837610 18:73357918-73357940 GATTAAATGCACACATAGGAAGG + Intergenic
1161598038 19:5162356-5162378 CATTGGAAGGACAATTTGGAAGG - Intronic
1162108093 19:8383040-8383062 CATTGGAAGGACAATTTGGAAGG + Intronic
1162237253 19:9319133-9319155 CATTGGAAGGACAATTTGGAAGG - Intergenic
1163661567 19:18581017-18581039 CATTAGAAGGACAATTTGGAGGG + Intronic
1165847276 19:38826289-38826311 CATTGGAAGGACAATTTGGAAGG + Intronic
1168680735 19:58313585-58313607 GATTAAAAACACAAACTGGCCGG - Intronic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926422123 2:12710217-12710239 GATTTGGTGCCCAAATTGGATGG + Intergenic
928274980 2:29892492-29892514 GATTAGAAGCAATTATTAGAGGG - Intronic
928617434 2:33054412-33054434 CATTGGAAGGACAATTTGGAAGG - Intronic
929523849 2:42681146-42681168 GATTTGAAGCACAATTTGAAAGG - Intronic
929909654 2:46078726-46078748 AATTAGAAGCACAACCTTGAAGG - Intronic
930038714 2:47104165-47104187 CATTGGAAGGACAATTTGGAAGG + Intronic
930397215 2:50838162-50838184 GATAAGAAACATAATTTGGAAGG - Intronic
931122159 2:59231827-59231849 GATTGCAAGGACAAATGGGAGGG + Intergenic
934867314 2:97824666-97824688 CATTGGAAGGACAATTTGGAAGG + Intronic
937107462 2:119331209-119331231 GTTCAGAAGCACAACTTGAAAGG - Intronic
938806006 2:134807835-134807857 CATTGGAAGGACAATTTGGAAGG - Intergenic
939852042 2:147314949-147314971 CATTGGAAGGACAATTTGGAAGG + Intergenic
943133934 2:183889015-183889037 CATTGGAAGGACAATTTGGAAGG + Intergenic
943672241 2:190675438-190675460 TATTAGAAGCACAAAGTGTTGGG + Intronic
943726504 2:191256827-191256849 AACTATAAGCACAAATGGGAAGG - Intronic
944431303 2:199636462-199636484 TTTTAGAAGCACAACTTAGAAGG + Intergenic
944729183 2:202500484-202500506 CATTGGAAGGACAATTTGGAAGG + Intronic
946207185 2:218118365-218118387 CATTGGAAGGACAATTTGGAAGG - Intergenic
1169385012 20:5141338-5141360 CATTAGATGCACACATTGCATGG - Intronic
1169706160 20:8507374-8507396 GATTTGAACAACAAATTGTATGG + Intronic
1170837026 20:19893465-19893487 GCTTAGAAACACAAACTGGATGG - Intronic
1174050061 20:47761303-47761325 GATGAGAAGCCCACATTGAACGG - Intronic
1175602755 20:60288288-60288310 AATAAGAAGCTAAAATTGGATGG - Intergenic
1176916473 21:14631702-14631724 AATTAGAAGCACAAAATTGGGGG - Intronic
1182654941 22:31882608-31882630 GATTAGAAGCAGAAAATTGGAGG + Intronic
949445214 3:4127834-4127856 GATTAGACCCAAAAATGGGAAGG + Intronic
951020669 3:17778015-17778037 CATTGGAAGGACAATTTGGAAGG + Intronic
951763128 3:26166267-26166289 GAGTAGAATCACAGAATGGAAGG - Intergenic
952453211 3:33450215-33450237 CATTGGAAGGACAATTTGGAAGG + Intergenic
953649266 3:44785634-44785656 AATTAGACACACAAATTGTATGG + Intronic
956323353 3:68023962-68023984 GATTAGATTCACAAATGAGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
958549047 3:95591911-95591933 CATTGGAAGGACAATTTGGAAGG - Intergenic
959269637 3:104191534-104191556 GATAAGAAGAACAAAGTAGAAGG + Intergenic
959489745 3:106974346-106974368 GATTAAAAGCACAGACTCGAGGG + Intergenic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
965062916 3:163805159-163805181 CATTGGAAGGACAATTTGGAAGG + Intergenic
965139369 3:164815062-164815084 CATTGGAAGGACAATTTGGAAGG + Intergenic
965307787 3:167088673-167088695 GAGTAGAACAACAAAATGGAAGG + Intergenic
966119550 3:176506895-176506917 GAGTAGTAGCACAAAATAGATGG - Intergenic
966196666 3:177320656-177320678 AATGAGGAGCACAATTTGGAGGG + Intergenic
967583834 3:191189336-191189358 CATTGGAAGGACAATTTGGAAGG + Intergenic
970184987 4:13442683-13442705 GATTTGAAGCAAGAATGGGAAGG + Intronic
970615425 4:17764353-17764375 GATTAGAGGTGCAATTTGGAGGG - Intronic
972133122 4:35861588-35861610 CATTGGAAGTACAATTTGGAGGG - Intergenic
972163638 4:36256276-36256298 GTTCAGAAGCACAGTTTGGAAGG - Intergenic
972178752 4:36439759-36439781 GCTTGGAAGCACAAACTGGGTGG - Intergenic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
974174675 4:58307931-58307953 CATTGGAAGGACAATTTGGAAGG + Intergenic
974537298 4:63188212-63188234 CATTGGAAGGACAATTTGGAAGG + Intergenic
974969194 4:68803839-68803861 CCTTAGAAGGACAATTTGGAAGG + Intergenic
975000700 4:69221444-69221466 CCTTAGAAGGACAATTTGGAAGG - Intergenic
975595654 4:76046606-76046628 CATTGGAAGGACAATTTGGAAGG - Intronic
976489049 4:85645672-85645694 AAAAAGAAGCACATATTGGAAGG + Intronic
976961792 4:90985575-90985597 AATTAGAAGCACCTATTGTATGG - Intronic
977771697 4:100868448-100868470 GCCTAGAAGCACAAACTGGGTGG - Intronic
977834762 4:101634704-101634726 CATTGGAAGGACAATTTGGAAGG - Intronic
979467969 4:121062182-121062204 GATTAGAAGCACAGAGTTAAAGG + Intronic
980290734 4:130845638-130845660 CATTGGAAGGACAATTTGGAAGG - Intergenic
980445563 4:132902470-132902492 TAGTAGAAGCACAAAAGGGATGG - Intergenic
983523587 4:168736781-168736803 AATTGGAAGCACAAACTTGAGGG - Intronic
984917619 4:184738016-184738038 CATTGGAAGGACAATTTGGAAGG + Intergenic
987545076 5:19303754-19303776 CATTGGAAGGACAATTTGGAAGG - Intergenic
987837838 5:23184642-23184664 CTTTAGAAGCAAGAATTGGAAGG - Intergenic
988019868 5:25608691-25608713 TAGGAGATGCACAAATTGGAAGG - Intergenic
988591847 5:32556281-32556303 CATTGGAAGGACAATTTGGAAGG - Intronic
989496342 5:42114440-42114462 AATTGGAAGGACAATTTGGAAGG + Intergenic
989565369 5:42896095-42896117 GATTAGAAGTACATATAGGTGGG - Intergenic
991038059 5:62147910-62147932 AATTATAAGCACAAAATCGAAGG - Intergenic
992049534 5:72929890-72929912 TATTGGAAGGACAATTTGGAAGG + Intergenic
992455360 5:76911079-76911101 CATTGGAAGGACAATTTGGAAGG + Intronic
993477033 5:88378911-88378933 GAATACAAGCACAAAGAGGATGG + Intergenic
993498559 5:88637522-88637544 GTTTAGAAGTACAAACTTGAAGG + Intergenic
995706590 5:114993965-114993987 CATTGGAAGGACAATTTGGAAGG + Intergenic
995738828 5:115333223-115333245 AATGAGGAGCACAAATTAGAAGG - Intergenic
996680377 5:126223750-126223772 CATTGGAAGGACAATTTGGAAGG + Intergenic
997152509 5:131513706-131513728 GCTTAGAAAGACAAATTGTAAGG - Intronic
998111621 5:139506904-139506926 TATTGGAAGGACAATTTGGAAGG + Intergenic
999649520 5:153751667-153751689 CATTAGAAGCACACATTTAAAGG + Intronic
1000085393 5:157883602-157883624 CATTGGAAGGACAATTTGGAAGG + Intergenic
1000178179 5:158778973-158778995 GATTACAAGAGCAAATTAGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003844719 6:10161155-10161177 GATTGGGAGGACAAATTGCAGGG + Intronic
1004451533 6:15752530-15752552 GAACAGAAGTAGAAATTGGAGGG - Intergenic
1006104988 6:31711061-31711083 AAATAGAAGCACAAAGTGGGAGG + Intronic
1007875394 6:45094321-45094343 GAAAAGAAACACAAATTGAAAGG + Intronic
1009470965 6:64028207-64028229 CATTGGAAGGACAATTTGGAAGG + Intronic
1009683610 6:66928440-66928462 CAGTAGTAGCACAAAATGGATGG + Intergenic
1009872938 6:69471708-69471730 CATTGGAAGGACAATTTGGAAGG + Intergenic
1010269979 6:73907376-73907398 CATTGGAAGGACAATTTGGAAGG + Intergenic
1011374893 6:86677805-86677827 CATTGGAAGGACAATTTGGAAGG - Intergenic
1012441390 6:99265226-99265248 CATTGGAAGGACAATTTGGAGGG - Intergenic
1013907694 6:115237568-115237590 CATTGGAAGGACAATTTGGAAGG - Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015026031 6:128533469-128533491 GATTAGTAGGATAAATCGGATGG + Intergenic
1015881318 6:137872785-137872807 GATTAAAACCACAAATTGTCAGG - Intronic
1016914437 6:149232035-149232057 GATCAGAAACAGAAATTTGAGGG + Intronic
1018801714 6:167227765-167227787 GAATAGAAGGACAGTTTGGAAGG + Intergenic
1020685326 7:11286590-11286612 GACAAGGAGCAGAAATTGGATGG - Intergenic
1021756571 7:23858519-23858541 CATTGGAAGGACAATTTGGAAGG - Intergenic
1022050986 7:26671580-26671602 TATTGGAAGAACAAAGTGGAGGG + Intronic
1024721963 7:52147463-52147485 GATAAGAAGCAAACATTTGATGG + Intergenic
1024870630 7:53959128-53959150 CATTGGAAGGACAAATTGGAAGG - Intergenic
1024882148 7:54099317-54099339 GAATAGAAGAACATATTGTAGGG + Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1028495074 7:91452749-91452771 CATTGGAAGGACAATTTGGAAGG - Intergenic
1029312600 7:99680891-99680913 GATGAGAGGCACAAACTGGTTGG - Intergenic
1029824443 7:103174328-103174350 GAATTGAAGCACAGAATGGATGG - Intergenic
1031731936 7:125311406-125311428 CATTGGAAGGACAATTTGGATGG + Intergenic
1031821894 7:126512526-126512548 GATTTGGAGCACATACTGGATGG - Intronic
1034579822 7:152032695-152032717 CATTGGAAGGACAATTTGGAAGG - Intronic
1037000903 8:13717592-13717614 GATCACAAGCACAAAATGGAAGG + Intergenic
1038171139 8:25133518-25133540 GAATAGAAGAACAAATTAGGTGG + Intergenic
1038638940 8:29308564-29308586 CATTGGAAGGACAAATTGGAAGG + Intergenic
1039999534 8:42564572-42564594 CATTGGAAGGACAATTTGGAAGG - Intergenic
1040667720 8:49653421-49653443 CATTGGAAGGACAATTTGGAAGG - Intergenic
1040964910 8:53073511-53073533 CATTGGAAGGACAATTTGGAAGG - Intergenic
1040971312 8:53139996-53140018 CATTGGAAGGACAATTTGGAAGG - Intergenic
1041002060 8:53463166-53463188 CATTGGAAGGACAATTTGGAAGG + Intergenic
1042341949 8:67688943-67688965 GATTACAACAACAAATGGGATGG - Intronic
1042504287 8:69543083-69543105 AATAAGAAGCATTAATTGGATGG - Intronic
1043217367 8:77609208-77609230 GACTAGAAGCACCATTTGGGTGG - Intergenic
1044456487 8:92397306-92397328 CATTGGAAGGACAATTTGGAAGG - Intergenic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1046472827 8:114701037-114701059 GATTAAAATCTGAAATTGGAAGG + Intergenic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1051935420 9:22438127-22438149 CATTGGAAGGACAATTTGGAAGG + Intergenic
1052057627 9:23922292-23922314 CATTGGAAGGACAATTTGGAAGG - Intergenic
1052289651 9:26826940-26826962 CATTGGAAGGACAATTTGGAAGG + Intergenic
1054730303 9:68695568-68695590 GGCTAGAACCACAAGTTGGAGGG + Intergenic
1056392633 9:86153694-86153716 CATTGGAAGGACAATTTGGAAGG - Intergenic
1058145873 9:101410721-101410743 AATTAGAATCAAAAATAGGAAGG + Intergenic
1185497725 X:568212-568234 AATTGGAACCACAGATTGGAGGG - Intergenic
1186768422 X:12793847-12793869 GATAAGAAGGTAAAATTGGAAGG - Intronic
1188677681 X:32963216-32963238 TATTAGACACAAAAATTGGAAGG + Intronic
1189790692 X:44600755-44600777 GATTAGAAGTACACAGTAGAAGG - Intergenic
1190566414 X:51734424-51734446 GACTAGGAGCTCAAATAGGAGGG - Intergenic
1195439717 X:104886336-104886358 CATTGGAAGGACAATTTGGAAGG + Intronic
1195756768 X:108206302-108206324 CTTTAGAGGCACAGATTGGATGG + Intronic
1195839853 X:109162540-109162562 GAATAGAAGAACAAAATTGAAGG + Intergenic
1196127206 X:112113213-112113235 CATTGGAAGGACAATTTGGAAGG - Intergenic
1196296444 X:114003021-114003043 GCTTTGAAGAACAGATTGGAGGG + Intergenic
1196671460 X:118372722-118372744 GATTAGAAGCACAAGTGAGAAGG + Intronic
1197513552 X:127398595-127398617 CATTGGAAGGACAATTTGGAAGG + Intergenic
1198001051 X:132436350-132436372 AATAAGAAGGGCAAATTGGATGG - Intronic
1198723149 X:139646636-139646658 GATAAGAAGTACAACTTAGAAGG - Intronic
1199832258 X:151558634-151558656 CATTGGAAGGACAATTTGGAAGG - Intergenic
1200800878 Y:7386308-7386330 GATTGGAAGGACAATTTGGAAGG - Intergenic
1201429836 Y:13892533-13892555 CATTGGAAGGACAATTTGGAAGG + Intergenic
1201487716 Y:14509901-14509923 CATTGGAAGGACAATTTGGAAGG + Intergenic
1201555884 Y:15264292-15264314 CATTGGAAGGACAATTTGGAAGG + Intergenic
1201568460 Y:15390261-15390283 TATTGGAAGGACAATTTGGAAGG - Intergenic
1201631391 Y:16074839-16074861 CATTGGAAGGACAATTTGGAAGG + Intergenic
1201729455 Y:17189052-17189074 CATTGGAAGGACAATTTGGAAGG - Intergenic
1201911217 Y:19135125-19135147 CATTGGAAGGACAATTTGGAAGG + Intergenic
1201981613 Y:19915598-19915620 ACTTAGAAGGACAATTTGGAAGG - Intergenic
1201989373 Y:20007903-20007925 CATTGGAAGGACAATTTGGAAGG - Intergenic
1202192467 Y:22259319-22259341 CATTGGAAGGACAATTTGGAAGG - Intergenic
1202258017 Y:22940894-22940916 CATTGGAAGGACAATTTGGAAGG + Intergenic
1202271903 Y:23081343-23081365 CATTGGAAGGACAATTTGGAAGG - Intergenic
1202294123 Y:23339339-23339361 CATTGGAAGGACAATTTGGAAGG + Intergenic
1202411007 Y:24574652-24574674 CATTGGAAGGACAATTTGGAAGG + Intergenic
1202424900 Y:24715087-24715109 CATTGGAAGGACAATTTGGAAGG - Intergenic
1202445889 Y:24954998-24955020 CATTGGAAGGACAATTTGGAAGG + Intergenic
1202459774 Y:25095420-25095442 CATTGGAAGGACAATTTGGAAGG - Intergenic