ID: 1157109714

View in Genome Browser
Species Human (GRCh38)
Location 18:44809207-44809229
Sequence TTGCCTTTATAGGAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157109714 Original CRISPR TTGCCTTTATAGGAGAGTGA AGG (reversed) Intronic
900328060 1:2120473-2120495 TTGCATTTATAGGAGAGACAGGG + Intronic
902761718 1:18585281-18585303 TTGCATTTTTAGTAGAGAGAGGG - Intergenic
904845677 1:33412894-33412916 TTGTCTTTATAGGAAACTCAGGG + Intronic
906965031 1:50447986-50448008 TTGCATTTTTAGAAGTGTGAGGG + Intronic
909724524 1:78818366-78818388 TAGACTCTATAGGAGAGTAAAGG - Intergenic
910871200 1:91834850-91834872 TTGCATTTTTAGTAGAGTCAGGG + Intronic
913024219 1:114819877-114819899 TTGCCTATAGAGGTGAATGAAGG - Intergenic
913235423 1:116776895-116776917 TTGCATTTTTAGAAGAGAGACGG - Intergenic
916433895 1:164759166-164759188 ATGCCTTTAAAGGATAGTGTCGG + Intronic
917985590 1:180314712-180314734 TTTCTTTTATAGGACAATGAAGG - Exonic
918009025 1:180569334-180569356 GTGTCTTTATAAGAGAGAGACGG + Intergenic
918071587 1:181137328-181137350 TTGCATTTTTAGTAGAGTCAGGG + Intergenic
918523900 1:185444247-185444269 TTGCATTTATAGTAGAGACAGGG + Intergenic
918640411 1:186833899-186833921 TTATCTTTAATGGAGAGTGATGG - Intronic
921297388 1:213717500-213717522 TTGAGTTTATATGAGAGGGATGG + Intergenic
921831545 1:219733020-219733042 CGACATTTATAGGAGAGTGAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922239301 1:223745149-223745171 TGGCCTGCATAGGAGAGTTAAGG + Intronic
922312535 1:224408983-224409005 TTGCCTGCATTTGAGAGTGAAGG - Intronic
1063123820 10:3123406-3123428 TTCCCTTTTTTGGAGACTGAAGG + Intronic
1063360635 10:5453914-5453936 CTGCCTTTATAGCCTAGTGAAGG + Intronic
1063612927 10:7578197-7578219 TTACCATTACAGGAGAGGGAAGG + Intronic
1066538744 10:36421060-36421082 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1066686298 10:37984707-37984729 TTGTCTTTTTAGTAGAGAGAGGG - Intergenic
1068083070 10:52344084-52344106 TTCCGTTTAAAGGAGATTGAAGG + Intergenic
1069701448 10:70429568-70429590 TTGCCTTTAGGGCAGAGTAAAGG - Intergenic
1070336182 10:75456846-75456868 TTGTATTTTTAGGAGAGTCAGGG + Intronic
1071475099 10:86019096-86019118 GTACTTTTATAGGAGAGGGAAGG - Intronic
1072129473 10:92479825-92479847 GTGACTTTATTGGAGAGAGAGGG - Intronic
1072643660 10:97234092-97234114 TTGCCTTTTTAGTAGAGAGGGGG - Intronic
1072971742 10:100023304-100023326 TTGCATTTTTAGGAGAGACAGGG - Intergenic
1075398602 10:122145114-122145136 TTACCTTTATAAGAAACTGAAGG - Intronic
1076071481 10:127493422-127493444 CTGGCTTTATAAGAGAGTGAGGG + Intergenic
1076213281 10:128670083-128670105 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1079146477 11:17856838-17856860 TTGGCTTTTTAGGAAAGTTAAGG - Intronic
1082053691 11:47794735-47794757 TTGCATTTTTAGTAGAGAGAGGG - Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085841997 11:80022726-80022748 TTGCATTTTTAGTAGAGTCAAGG + Intergenic
1086077648 11:82871599-82871621 TTGCCTTTTTTGGAGGTTGAGGG - Intronic
1086420309 11:86631903-86631925 TTGTATTTTTAGGAGAGAGAGGG + Intronic
1086493114 11:87375672-87375694 TTGCTTAAATAGGAGAATGAAGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088199390 11:107314845-107314867 TTAACTTTATAGTAGAGGGAGGG - Intergenic
1088490474 11:110382337-110382359 TTAACTTTATAGGAGACTGCTGG + Intergenic
1090903808 11:131056033-131056055 TTCCCTTCAGAAGAGAGTGAGGG - Intergenic
1091493926 12:955951-955973 TTGCATTTTTAGTAGAGAGAGGG + Intronic
1091975576 12:4822005-4822027 TTGCATTTTTAGGAGAGAGGGGG + Intronic
1092551148 12:9501461-9501483 TTGCATTTTTAGTAGAGAGACGG + Intergenic
1094520657 12:31184895-31184917 TTGCATTTTTAGTAGAGAGACGG - Intergenic
1095613555 12:44161485-44161507 TTTCCTTAAAAGGAAAGTGAGGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1100244308 12:92741698-92741720 GTTCCTTTGTAGGAGAGTGGAGG - Intronic
1101483201 12:105123139-105123161 TTGCATTTTTAGTAGAGAGAAGG - Intronic
1101683992 12:106998868-106998890 TTGCATTTTTAGTAGAGAGAGGG - Intronic
1102110587 12:110363012-110363034 TTGTGTTTATAGTAGAGTCAGGG - Intergenic
1105286694 13:19009936-19009958 ATGTCTTTTTAGGAGAGTGTTGG - Intergenic
1105374662 13:19832497-19832519 TTGCCTTTTTAGTAGAGACAGGG + Intronic
1105939730 13:25136983-25137005 TGGCATTTAAAAGAGAGTGAAGG - Intergenic
1106270184 13:28145497-28145519 TTGCCTTTTTAGTAGAGACAGGG + Intronic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1107479324 13:40772157-40772179 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
1107532919 13:41301573-41301595 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
1109095773 13:58114585-58114607 TTGGATTTATATGAGGGTGAGGG + Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1110744505 13:79037198-79037220 TTGTCTTGATAGGAGGGTGAGGG + Intergenic
1113256199 13:108508850-108508872 GTGTCTTTTTGGGAGAGTGAGGG + Intergenic
1114066666 14:19065398-19065420 TTGTCTTTATAGGAGCTTTATGG + Intergenic
1114095601 14:19334629-19334651 TTGTCTTTATAGGAGCTTTATGG - Intergenic
1116643048 14:47489688-47489710 TTCCCTTTATAAGATGGTGATGG - Intronic
1116651932 14:47604498-47604520 TTGTCTTTATAGGGGGGTGAGGG - Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1118954586 14:70468469-70468491 TTGTATTTTTAGGAGAGAGAGGG - Intergenic
1119747601 14:77055361-77055383 TTTCCATTAGAGGAGAATGATGG + Intergenic
1120900935 14:89574916-89574938 GTGCCTTTATAGGAAAGGAAGGG + Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122277433 14:100601799-100601821 TTGCATTTTTAGCAGAGAGAGGG + Intergenic
1124031148 15:26013509-26013531 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1126300649 15:47192181-47192203 TGGCCTTCATCTGAGAGTGAGGG - Intronic
1127060117 15:55173918-55173940 TTGCTTTTAGAGAAGAGGGAAGG + Intergenic
1127742058 15:61919285-61919307 TTACCTGTAGAGGAGAGCGAAGG + Exonic
1127878172 15:63130334-63130356 TTGCATTTTTAGTAGAGAGAGGG - Intronic
1127968310 15:63940205-63940227 TTTCCTTTAGAGTGGAGTGAAGG - Intronic
1128022498 15:64404491-64404513 TTGCATTTATAGTAGAGACAGGG + Intronic
1130830217 15:87591656-87591678 TTGCCTTTCTAGGAGAGAGGAGG - Intergenic
1131163350 15:90124353-90124375 TTGCATTTTTAGGAGAGACAAGG + Intergenic
1132988028 16:2777970-2777992 TTACATTTACATGAGAGTGAGGG + Intergenic
1133068267 16:3226224-3226246 TTGTATTTATAGTAGAGAGAGGG + Intronic
1133574796 16:7078518-7078540 TTGTATTTTTAGGAGAGTCAGGG + Intronic
1137443533 16:48516614-48516636 TTGCATTTTTAGGAGAGACAGGG - Intergenic
1137646808 16:50082167-50082189 TTGCCTTTTTAGTAGAGACAGGG - Intronic
1138268413 16:55677327-55677349 TTTCCTTTATGGGAGGATGAGGG - Intronic
1139032836 16:62906200-62906222 TTTTCTTTATAGAAGAGTTAGGG + Intergenic
1139312240 16:66037403-66037425 TTGCCAAGATAGGAGAGGGAGGG + Intergenic
1140087535 16:71810080-71810102 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1140936970 16:79681152-79681174 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1141329760 16:83099937-83099959 TTGGCTTTGTAGGACAGTGTGGG - Intronic
1141587555 16:85044942-85044964 TTGCATTTTTAGTAGAGAGAGGG - Intronic
1143943577 17:10568847-10568869 TTGCATTTTTAGTAGAGAGAGGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147142531 17:38467320-38467342 TCCCCTTTATTGGTGAGTGATGG + Exonic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148370587 17:47096887-47096909 TTGTCTTTTTAGTAGAGTCAAGG - Intergenic
1149587137 17:57798768-57798790 TTGCCTTTTTAACAGAGTAAAGG - Intergenic
1150912150 17:69399526-69399548 TTGCATTTATAGTAGAGATAGGG - Intergenic
1151923570 17:77176115-77176137 TTGCCTTTTTAGTAGAGACAGGG - Intronic
1152260449 17:79263926-79263948 TTGCCTTTATAAGAGAAAGGAGG + Intronic
1152602674 17:81272672-81272694 TTTGCTTTCTAGGAGAGTGGTGG - Intronic
1153023654 18:655135-655157 TTGCATTTTTAGGAGAGACAGGG - Intronic
1153027359 18:683847-683869 GTGCCATTATGGGAGAGTTAAGG - Intronic
1153160546 18:2200029-2200051 TTGCCTTTTTAGTAGAGACAGGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155811778 18:30245606-30245628 TTGCCTTTATTTGTGTGTGATGG + Intergenic
1155966267 18:32038220-32038242 TTGTCTTTTTAGTAGAGAGAGGG + Intronic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1157851572 18:51057952-51057974 TTGCCTTTATAGATGACTGTAGG + Intronic
1158945960 18:62447188-62447210 TGCCCTTTGAAGGAGAGTGAGGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1161110828 19:2469035-2469057 TTGCATTTTTAGGAGAGAGGGGG + Intergenic
1163772805 19:19200970-19200992 TTGCATTTTTAGTAGAGTCAGGG + Intronic
1163918352 19:20263525-20263547 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1164675899 19:30101240-30101262 GTTCCATTACAGGAGAGTGAGGG + Intergenic
1166257147 19:41614883-41614905 TTGGCTTTATAGGGAAGGGAAGG + Intronic
1167989824 19:53349030-53349052 TTGCATTTTTAGTAGAGTTAGGG + Intronic
925435330 2:3832452-3832474 TTGTGTTTGTAGGAGAGTGTTGG + Intronic
925591560 2:5515032-5515054 TTGCCTTTTTAGTAGAGCCAGGG + Intergenic
928076249 2:28267351-28267373 CTGCATTTATGGGGGAGTGAGGG - Intronic
928183071 2:29083486-29083508 TTGCCTTTTTAGTAGAGATAGGG + Intergenic
928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG + Intronic
928624100 2:33121865-33121887 TAGTCTTTATAGGAGAGAGAAGG + Intronic
930174806 2:48290833-48290855 TTGCCTCTGAAGGAGAGGGAGGG + Intergenic
931433517 2:62228659-62228681 TTGGCTTTGTAGTGGAGTGATGG - Intergenic
932018954 2:68063086-68063108 TTGCCTTTGGAGAAGAGTTAAGG - Intronic
932081788 2:68722403-68722425 TTGCATTTTTAGTAGAGTCAGGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
935330571 2:101974598-101974620 TTGCCCTGATTGGAGAGTGATGG - Intergenic
935406568 2:102716308-102716330 TTGCCTGTTTCTGAGAGTGAAGG + Exonic
935685443 2:105678806-105678828 TTTCCTTTATAGGGGTTTGAGGG + Intergenic
935857398 2:107289815-107289837 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
937274510 2:120675290-120675312 TTGCTTTTAAAGGACAGTAAGGG - Intergenic
937651282 2:124321975-124321997 TTGCCTTTTTAGTAGAGACAGGG - Intronic
937740513 2:125347240-125347262 TTTGCTTTATCGGAGAGTGTTGG + Intergenic
938484059 2:131685498-131685520 TTGTCTTTATAGGAGCTTTATGG + Intergenic
940598945 2:155832896-155832918 TTGCCTTTCTTTGAAAGTGAAGG - Intergenic
940955487 2:159722308-159722330 TTGTATTTATAGTAGAGAGAGGG + Intronic
941160234 2:162027176-162027198 TTGCATTTTTAGTAGAGTCAGGG - Intronic
941161683 2:162043032-162043054 TTGCCTTTAGATGGGAATGAGGG + Intronic
941940184 2:171027988-171028010 TTGTATTTTTAGTAGAGTGAGGG - Intronic
942236415 2:173911988-173912010 TTGTCTTTCTAGGAGAGACACGG + Intronic
944230364 2:197386184-197386206 TTGCCTTTTTAGTAGAGACAGGG + Intergenic
944378885 2:199083106-199083128 TTCCCTTTGTAGGATATTGAAGG - Intergenic
945517620 2:210782650-210782672 TTGTCATTGTATGAGAGTGAAGG - Intergenic
946075646 2:217071413-217071435 TTGCCCTTATGGGAGCCTGAGGG + Intergenic
946956891 2:224940681-224940703 CTGCTGTCATAGGAGAGTGATGG - Intronic
1169965757 20:11215443-11215465 TTACCTTTATAAGGGAGGGAGGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1170942650 20:20861971-20861993 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1172105393 20:32514317-32514339 TTGAATTTTTAGGAGAGTGGGGG - Intronic
1172362668 20:34325066-34325088 TTACTTTTATTGTAGAGTGAGGG - Intergenic
1172546995 20:35770042-35770064 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1175301329 20:57945354-57945376 ATGCCTGTATTGGAGAGTGCAGG - Intergenic
1175433175 20:58921668-58921690 TTGCATGCAGAGGAGAGTGAAGG + Intergenic
1175644301 20:60658156-60658178 CTGCCTGCACAGGAGAGTGATGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179119566 21:38530230-38530252 TTGCATTTTTAGTAGAGAGAGGG + Intronic
1180485147 22:15787982-15788004 TTGTCTTTATAGGAGCTTTATGG + Intergenic
1181281438 22:21723538-21723560 TTGCATTTTTAGGAGAGACAGGG + Intronic
1181613454 22:24035432-24035454 TTTCCTTTCTAGGAGAGTTGTGG + Exonic
1181847998 22:25728638-25728660 TTGCCTTTTTCAAAGAGTGAAGG - Exonic
1182588699 22:31362535-31362557 TTGCATTTTTAGTAGAGAGACGG + Intergenic
1183325688 22:37191661-37191683 TTCCCTTTATCGGTGAGTAAAGG - Intronic
1184044222 22:41962542-41962564 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
950076261 3:10189380-10189402 TTGCTTTCACCGGAGAGTGAAGG + Intronic
953597889 3:44335449-44335471 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
954775840 3:53017723-53017745 TTGCTTTTTTTGAAGAGTGAAGG - Intronic
955310288 3:57879991-57880013 TTACCTTTATGGGAGAGGAAGGG + Intronic
959185087 3:103036654-103036676 TTGGCTTTCTAGGTGTGTGATGG - Intergenic
960270401 3:115667844-115667866 TAGCCTTTTTAGCTGAGTGATGG + Intronic
960664952 3:120099720-120099742 TTGTGTTTTTAGTAGAGTGAGGG + Intergenic
963146194 3:141997675-141997697 TTGTATTTTTAGGAGAGTTAGGG - Intronic
963600076 3:147371390-147371412 TTGCGATTACAGGAGAGGGAAGG - Intergenic
964092773 3:152895614-152895636 TTCCCTTCATAGGACAATGAAGG + Intergenic
964800037 3:160546343-160546365 TTGTGTTTATAGTAGAGTCAGGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965152651 3:164999833-164999855 TTGCCTTTATTAGCAAGTGATGG - Intronic
965566606 3:170125720-170125742 TCGCCTTTATATGAGAGTTCTGG - Intronic
966953948 3:184853845-184853867 TTGCATTTTCAGGAGAGTGATGG + Exonic
968488727 4:878214-878236 TTGCATTTTTAGTAGAGAGAGGG - Intronic
971141040 4:23924906-23924928 TTTCTTTTATAGAAGAGTGATGG + Intergenic
972656018 4:41064335-41064357 TTTTCTTTATAGGAAAGTTATGG - Intronic
973970362 4:56207398-56207420 CTGCCTATCCAGGAGAGTGAAGG + Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975469696 4:74751462-74751484 GGGCATTTAGAGGAGAGTGAAGG - Intronic
975521721 4:75308898-75308920 TTGCCTTTAAAGGAGAGATTAGG + Intergenic
976088675 4:81432341-81432363 TTGGCTTCTTATGAGAGTGAAGG - Exonic
977796609 4:101173188-101173210 TTGCCTTTATTGGGGGATGAGGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979885953 4:126028079-126028101 TTTGCTGTATAGGAGAGTAAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
982971650 4:161995923-161995945 TGGCCTTTTTAGGACACTGATGG - Intronic
984821567 4:183887084-183887106 TTGCATTTTTAGGAGAGACAGGG - Intronic
986408014 5:7446638-7446660 TTGTTTTTATAGGTGAGAGAGGG + Intronic
988100486 5:26669979-26670001 TTGCCTTAATAATAGAGTCAGGG - Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
992256823 5:74929529-74929551 TTGCATTTTTAGTAGAGAGATGG - Intergenic
993135603 5:83957668-83957690 TTTCTTCTATTGGAGAGTGATGG + Intronic
993310242 5:86321219-86321241 TTTACTTTTTAGGAGAGTTAAGG - Intergenic
993451985 5:88083102-88083124 TTTCCTTTTTGGGGGAGTGAAGG + Intergenic
993481342 5:88428474-88428496 TTGGCTTTTTAGGTCAGTGATGG + Intergenic
993491566 5:88557934-88557956 ATTCCTTTATTGGAGAGGGAGGG + Intergenic
993922838 5:93828814-93828836 TTGCCTGCATAGGAGTGTGGTGG + Intronic
996145262 5:119967028-119967050 TTGCTTTTATGGGAGAGGAAAGG + Intergenic
997889300 5:137660814-137660836 TTGCCTTTATAGGATTGTTTGGG - Intronic
998046033 5:138987574-138987596 TGCCCTTTAGAGGAGTGTGAGGG - Intronic
1000021866 5:157325186-157325208 ATGGCTTTGTAGGAGAGGGATGG + Intronic
1000885912 5:166746952-166746974 TTGCATTTTTAGTAGAGAGAGGG - Intergenic
1003180350 6:3785523-3785545 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1003419396 6:5942207-5942229 TGGCCTTCATAAGAGAGGGAAGG + Intergenic
1004902943 6:20210662-20210684 TTACCTTTATAGGAAAGTAGGGG + Intronic
1005051689 6:21689855-21689877 TTGGCTTTGCAGGAGAGTGAGGG + Intergenic
1005278488 6:24245020-24245042 TTGTATTTTTAGGAGAGTCAGGG - Intronic
1005291972 6:24388726-24388748 CTACCTTTATATGAGATTGATGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006076783 6:31538326-31538348 TTGCATTTTTAGTAGAGAGAGGG + Intronic
1006387160 6:33737678-33737700 GTGCCTCTATAGGAGGGAGAAGG + Intronic
1006703003 6:35992342-35992364 TTTCCTTTATTGGAGAATTAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007375390 6:41452759-41452781 TTGCATTTTTAGTAGAGTGGGGG + Intergenic
1008761590 6:54858343-54858365 CTACCTTTAGAGTAGAGTGAGGG + Intronic
1009791880 6:68412375-68412397 CAGCCTTGATAGGACAGTGATGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013204153 6:107931573-107931595 TTGTCTTTTTAGTAGAGAGAGGG - Intronic
1014165150 6:118215882-118215904 TTCCTTTGATAGAAGAGTGATGG - Intronic
1014425170 6:121295610-121295632 TTGACTATATAGGAGAGAAAGGG + Intronic
1015535817 6:134266440-134266462 TTGTATTTTTAGGAGAGTCAGGG - Intronic
1017519504 6:155189171-155189193 TTTCCTGTTTATGAGAGTGAGGG + Intronic
1018197433 6:161367412-161367434 TGGCCTTGATTGGAGAGTTAGGG + Intronic
1019379682 7:714273-714295 GTGCCTCTAGAGGAGAGTGGAGG + Intronic
1020527161 7:9276425-9276447 TTGCATTTTTAGTAGAGAGAGGG + Intergenic
1020822920 7:12992561-12992583 TTTACTTTCTAGGAGGGTGATGG + Intergenic
1022035212 7:26527597-26527619 TTTCCTTTTTTGGAGAGAGATGG - Intergenic
1023011916 7:35931617-35931639 TTGACTGTAAAGGGGAGTGAAGG - Intergenic
1023692995 7:42811517-42811539 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
1023760325 7:43459708-43459730 TTGCATTTTTAGTAGAGAGAAGG + Intronic
1024079215 7:45842245-45842267 TTGCCTGTAAAGGGGAGGGAAGG + Intergenic
1024790945 7:52964298-52964320 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025162478 7:56674249-56674271 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025187424 7:56871731-56871753 TTGCATTTTTAGTAGAGTCAGGG + Intergenic
1025188838 7:56881535-56881557 TTGCATTTTTAGTAGAGTCAGGG + Intergenic
1025684501 7:63705189-63705211 TTGCATTTTTAGTAGAGTCAGGG - Intergenic
1025817075 7:64923512-64923534 TTGTATTTTTAGTAGAGTGAGGG + Intronic
1025875650 7:65477946-65477968 TTGCGTTTTTAGTAGAGAGAGGG + Intergenic
1026707163 7:72704259-72704281 TTGTCTTTATAGTAGAGACAGGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028513561 7:91651253-91651275 TTTCCTTTAAAGGAGAGAGTAGG - Intergenic
1029046757 7:97638104-97638126 TTCCATTTATATGAAAGTGAAGG + Intergenic
1031009592 7:116512110-116512132 TTGCCTTTATAGGAAAAGGTAGG + Intergenic
1032184179 7:129709400-129709422 TTCTCTTTATAGTATAGTGATGG - Intronic
1032870580 7:135980241-135980263 TATCCATTATAGGACAGTGAGGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033217722 7:139505716-139505738 TTGCCTTTAGAGGAGAAGGCAGG - Intergenic
1033337857 7:140468526-140468548 TTGCATTTTTAGTAGAGTTAGGG - Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1033969918 7:147026030-147026052 TTGCCTTTTTAGTAGAGACAGGG + Intronic
1037292495 8:17366180-17366202 TTTCCTTTATATGGGAGAGAAGG - Intronic
1037330414 8:17738455-17738477 TTGCCTCCAAAAGAGAGTGAAGG + Intronic
1037908961 8:22732230-22732252 TTCCCTTGCTAGGAGAGTCATGG - Intronic
1038409280 8:27345537-27345559 TTGCCTTTACAGGGGAATCAGGG - Intronic
1038577705 8:28718969-28718991 TTGGCATTCTAGGAGAGAGATGG + Intronic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039696339 8:39916302-39916324 TTGCATTTTTAGTAGAGTCAGGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041072123 8:54135474-54135496 TGCCCTTTCTAGGAGAGTGTTGG + Intronic
1042525533 8:69761117-69761139 CTTCCTTTATAGCAGAGTGAAGG - Intronic
1042703906 8:71646707-71646729 TTGGCTTTATAGCAGAGGGCAGG - Intergenic
1042712533 8:71734273-71734295 TCGACTTTAAAGGAGAGTGCTGG - Intergenic
1042843125 8:73144753-73144775 TTGACTGTAAAGGGGAGTGAAGG - Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1044691621 8:94885889-94885911 TTGCATTTTCAGGAGAGAGAGGG + Intronic
1045711922 8:104994893-104994915 TTTCTTTCATAGGTGAGTGAAGG - Intronic
1046155720 8:110287514-110287536 TTGTCTTTGTCAGAGAGTGAGGG - Intergenic
1046997096 8:120535411-120535433 TTGCATTTTTAGGAGAGACACGG + Intronic
1047494186 8:125397981-125398003 GTGCCTGTATAGGGCAGTGAAGG - Intergenic
1050229383 9:3502892-3502914 TTAACTTTAAAGGAGAGTGATGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050529087 9:6572504-6572526 TTGCTTTCATAGGGGAGTGTAGG - Intronic
1050692155 9:8240399-8240421 TTGCCTTTTTAGTAGAGTCGAGG - Intergenic
1054969541 9:71069349-71069371 TTGCATTTTTAGTAGAGTCAGGG + Intronic
1055720153 9:79164175-79164197 TTGCATTTTTAGGAGAGACAGGG - Intergenic
1056410533 9:86321730-86321752 TTTCCTTTTTTGGAGGGTGATGG - Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058587511 9:106526145-106526167 TTGCCTAGAAAGAAGAGTGACGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187677267 X:21728793-21728815 TTTTGTTTATGGGAGAGTGAAGG - Intronic
1187860551 X:23678455-23678477 TTGCATTTTTAGTAGAGTCAGGG - Intronic
1187974905 X:24695159-24695181 TTTCCTTTAGAGCAGACTGAAGG + Intronic
1189683683 X:43542154-43542176 ATGCCTTTATATGAGGGAGAGGG - Intergenic
1190433327 X:50398945-50398967 TTGCCTAGTTAGGAGAATGAGGG - Intronic
1190446839 X:50534249-50534271 TTGACTTTACAGGAGAAAGACGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1196859545 X:120014678-120014700 TTGACTTTGGAGGAGAGGGAAGG + Intergenic
1198748534 X:139915495-139915517 TTGCATTTTTAGTAGAGTCAGGG - Intronic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201295719 Y:12461656-12461678 TTGTATTTTTAGGAGAGTCAGGG + Intergenic