ID: 1157110250

View in Genome Browser
Species Human (GRCh38)
Location 18:44813901-44813923
Sequence GAGTTGTAGGAGAGTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 597}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157110242_1157110250 0 Left 1157110242 18:44813878-44813900 CCCTGGAACCTCCAAATCTCCTG 0: 1
1: 0
2: 15
3: 312
4: 541
Right 1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 597
1157110245_1157110250 -8 Left 1157110245 18:44813886-44813908 CCTCCAAATCTCCTGGAGTTGTA 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 597
1157110243_1157110250 -1 Left 1157110243 18:44813879-44813901 CCTGGAACCTCCAAATCTCCTGG 0: 1
1: 0
2: 0
3: 41
4: 571
Right 1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157110250 Original CRISPR GAGTTGTAGGAGAGTGCTGG AGG Intronic
900015085 1:142784-142806 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
900016688 1:155606-155628 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
900045352 1:501393-501415 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
900046949 1:514198-514220 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
900067549 1:743123-743145 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
900069152 1:755916-755938 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
902200609 1:14830786-14830808 GTGTTGTGGGAGGGTCCTGGTGG - Intronic
902803598 1:18846823-18846845 GCGTTGGAGGTGAGTCCTGGTGG + Intronic
902927746 1:19708004-19708026 GTGTTGAAGGAGAGGCCTGGTGG - Intronic
904895326 1:33813055-33813077 GAGGTGTAAGATGGTGCTGGTGG - Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
906575657 1:46886933-46886955 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
906596319 1:47080963-47080985 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
908266470 1:62384316-62384338 GAGTTGGAGGAGGGGCCTGGTGG + Intergenic
908351353 1:63288433-63288455 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
908548032 1:65181251-65181273 AAGATGCAGGATAGTGCTGGAGG - Intronic
908911329 1:69074639-69074661 GTGTTGTAGGAGGGACCTGGAGG - Intergenic
909825827 1:80126348-80126370 GAGAAGGAGGAGAGTGCTGAAGG + Intergenic
910114969 1:83721939-83721961 GAGTTGAGGGAGAGACCTGGTGG + Intergenic
912253150 1:108031731-108031753 GATTTGCAAGAGAATGCTGGAGG + Intergenic
913435734 1:118845499-118845521 GAGTTATAGGAGGGACCTGGTGG - Intergenic
913587717 1:120292429-120292451 GAGTTCTAGGAGCTTTCTGGAGG + Intergenic
913620468 1:120605940-120605962 GAGTTCTAGGAGCTTTCTGGAGG - Intergenic
915828163 1:159101134-159101156 GTGTTGTAGGAGGGACCTGGTGG + Intronic
917098634 1:171424451-171424473 GAGATGTATGAGAATGCTGCTGG + Intergenic
919431844 1:197503577-197503599 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
919501390 1:198341846-198341868 GAGGAGTAGGAGAGCGCTGGGGG + Intergenic
919579088 1:199349172-199349194 GTGTTGGAGGAGAGACCTGGTGG + Intergenic
920271796 1:204770680-204770702 GTGTTGGAGGAGAGGTCTGGTGG - Intergenic
920616012 1:207493377-207493399 GAGGTGTATGATAGTGCTGGAGG + Intergenic
921970299 1:221141169-221141191 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
922102152 1:222485896-222485918 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
922104513 1:222501308-222501330 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
922151130 1:223005282-223005304 TAGTGGTAGGAGAGCACTGGTGG - Exonic
922263235 1:223961007-223961029 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
922264831 1:223973821-223973843 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
922373752 1:224939852-224939874 GTGTTGGAGGAGGGTCCTGGTGG + Intronic
922416148 1:225425208-225425230 GAGTAGTGGGAGAGTGGGGGGGG + Intronic
922751148 1:228070578-228070600 GTGTAGTGGGAGAGTGCAGGGGG + Intergenic
923351916 1:233115693-233115715 GAGATGTATGAGAGTTCTAGTGG + Intronic
924325209 1:242888855-242888877 GAGTTTTAGGAGAGTTGTTGGGG - Intergenic
924345075 1:243066016-243066038 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
924346688 1:243078827-243078849 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
924832016 1:247606213-247606235 GAGATGGAGATGAGTGCTGGTGG - Exonic
1063928248 10:11002298-11002320 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
1064647019 10:17470307-17470329 GTGTTGTAGGAGGGAGCCGGTGG + Intergenic
1064863696 10:19854769-19854791 GAGGTGTTGGAGAGTGCCAGGGG + Intronic
1065194728 10:23252897-23252919 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1066345551 10:34581752-34581774 GAGTTGAACCACAGTGCTGGAGG + Intronic
1066483929 10:35825657-35825679 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1066552488 10:36574719-36574741 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
1067018358 10:42773956-42773978 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1067457985 10:46437107-46437129 GTGTTGGAGGAGAGGCCTGGGGG - Intergenic
1067469816 10:46528239-46528261 GAGCTGGAGGAAAGGGCTGGTGG - Intergenic
1067629212 10:47947527-47947549 GTGTTGGAGGAGAGGCCTGGGGG + Intergenic
1068530094 10:58175899-58175921 GAATTGTAGGTGTGTGCTGAGGG - Intergenic
1069242368 10:66159039-66159061 CAGTTCTAGGAGATTTCTGGAGG + Intronic
1070288404 10:75099769-75099791 GAGTTATGGCAGAGTGCTGGGGG - Intronic
1071437289 10:85659274-85659296 AAGATGGAGGAGAGTGCTGCTGG + Intronic
1072824861 10:98597150-98597172 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1075114811 10:119617249-119617271 GTGTTGTGGGAGAGACCTGGGGG + Intergenic
1075889342 10:125932596-125932618 CAGTTGTAGGAGCTTTCTGGAGG + Intronic
1076595641 10:131623172-131623194 GAGGTGGGGGAGAGAGCTGGGGG + Intergenic
1076595701 10:131623341-131623363 GAGAGGTAGGAGAGAGGTGGGGG + Intergenic
1076596297 10:131624867-131624889 GAGGTGGAGGAGAGAGGTGGGGG + Intergenic
1076698760 10:132259364-132259386 GTGTTGGAGGAGGGTCCTGGTGG + Intronic
1076698779 10:132259456-132259478 GTGTTGGAGGAGGGTCCTGGTGG + Intronic
1076973278 11:150675-150697 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1077932668 11:6750801-6750823 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1078846433 11:15122970-15122992 GAGATGTAGGAGAGGGCAGCAGG - Intronic
1078978730 11:16506669-16506691 GTGTTGGAGGAGGGAGCTGGTGG + Intronic
1079656008 11:22987644-22987666 GTGTTGTGGGAGGGTCCTGGTGG - Intergenic
1080044912 11:27798661-27798683 GGGTTGGAGGAGAGGCCTGGTGG + Intergenic
1080143108 11:28945885-28945907 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
1081298688 11:41423902-41423924 GTGTTGTAGGAGGGACCTGGTGG + Intronic
1082614933 11:55348273-55348295 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1083267320 11:61552716-61552738 GAGGTGTAGGGCACTGCTGGTGG - Intronic
1085008754 11:73120146-73120168 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
1085745481 11:79111026-79111048 GAGTTGTGGGAGGGAGCCGGTGG + Intronic
1087321810 11:96670564-96670586 CAGTTCTAGGAGCTTGCTGGAGG - Intergenic
1087335013 11:96833190-96833212 CTGTTGTAGGAGTGAGCTGGTGG + Intergenic
1087928737 11:103950808-103950830 TAGTTGAAGCTGAGTGCTGGTGG + Intronic
1088561213 11:111118183-111118205 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1089322234 11:117634200-117634222 GAGGTGTAGGAGAGTGTGGACGG + Intronic
1089808106 11:121109783-121109805 GTTTTGCAGGAGAGTGCTTGAGG + Intronic
1090756226 11:129794315-129794337 GTGTTGCAGGAGGGGGCTGGTGG - Intergenic
1091862696 12:3800940-3800962 GAGAGATAGGAGAGTTCTGGTGG - Intronic
1092408252 12:8235503-8235525 AAGTTCTAGGACAGTCCTGGCGG + Intergenic
1092642912 12:10536946-10536968 GAGTTGTGGGAGGGGCCTGGTGG - Intergenic
1092914547 12:13178149-13178171 GAGGTGGGGGAGAGTGCGGGTGG + Intergenic
1093230751 12:16539056-16539078 ATGTTGTGGGAGAGAGCTGGTGG - Intronic
1094132225 12:27086413-27086435 GTGTTTTGGGAGAGAGCTGGTGG - Intergenic
1094762443 12:33550255-33550277 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
1095928971 12:47607039-47607061 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1096245435 12:49982474-49982496 GAGGTGGTGCAGAGTGCTGGGGG - Intronic
1097163372 12:57066750-57066772 GTGTTGTAGGAGGGAACTGGTGG + Intronic
1097442980 12:59633876-59633898 GTGTTGAAGGAGGGAGCTGGTGG - Intronic
1097654855 12:62345935-62345957 GTGTTGTGGGAGGGTCCTGGTGG - Intronic
1098356917 12:69620736-69620758 GAGTTGGAGGTGGGGGCTGGTGG + Intergenic
1098689565 12:73469764-73469786 CAGTTGTAGGAGCTTTCTGGAGG + Intergenic
1098886447 12:75965309-75965331 GAGTGGTAGGGGAGTGAGGGTGG + Intergenic
1099929238 12:89054127-89054149 GAGTTGCAGGAGGGACCTGGTGG - Intergenic
1099937982 12:89150839-89150861 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1099974104 12:89528476-89528498 GTGTTGGAGGAGGGGGCTGGTGG + Intergenic
1100179822 12:92073219-92073241 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1100434615 12:94560433-94560455 AAGTTTTAGGGGAGTGCTGGGGG + Intergenic
1100748531 12:97672123-97672145 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
1100972832 12:100089847-100089869 GTGTTGTGGGAGAGACCTGGTGG + Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101472997 12:105016718-105016740 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1101909214 12:108849987-108850009 GAGCTCTAGGAGGGAGCTGGGGG + Intronic
1102192179 12:110996985-110997007 GTGTTGTGGGAGGGTCCTGGTGG + Intergenic
1104138347 12:125961966-125961988 GTGTTGTAGGAGGGATCTGGTGG + Intergenic
1104245797 12:127040295-127040317 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1104958645 12:132477829-132477851 GTGGGGCAGGAGAGTGCTGGGGG - Intergenic
1105274484 13:18906654-18906676 GAGTGGTAGGAGAGTGTCTGCGG + Intergenic
1106257093 13:28031730-28031752 GGGTGGGAGGACAGTGCTGGGGG + Intronic
1106280789 13:28267805-28267827 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
1106487511 13:30185434-30185456 GAGTTGTGGGAGAGACCTGGTGG - Intergenic
1106635964 13:31528733-31528755 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
1108787644 13:53925003-53925025 GAGTTCTAGGAGCTTTCTGGAGG - Intergenic
1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG + Intergenic
1108974061 13:56414485-56414507 GAGTTGAACGAGATTGGTGGTGG + Intergenic
1109404302 13:61877573-61877595 GTGTTGCAGGAGAGAGTTGGAGG + Intergenic
1109440660 13:62368016-62368038 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1109954660 13:69549914-69549936 GTGTTGGAGGACAGGGCTGGTGG - Intergenic
1110044800 13:70814107-70814129 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1110455672 13:75687905-75687927 GTGTTGTAGGAGGGACCTGGTGG + Intronic
1110926379 13:81159413-81159435 GTGTTGGAGGTGAGTCCTGGTGG + Intergenic
1111217703 13:85165441-85165463 GACTTGGAGGAGGGGGCTGGTGG + Intergenic
1111490189 13:88962095-88962117 GTGTTGTAGGAGAGACCTGGTGG - Intergenic
1112197714 13:97242148-97242170 GAGGTCTAGGAGTGTGTTGGGGG - Intronic
1112653079 13:101419301-101419323 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1112861395 13:103832539-103832561 GTGTTGTAGGAGGGACCTGGCGG - Intergenic
1113035621 13:106045273-106045295 GAGTTGTATGGAAGTACTGGTGG - Intergenic
1113484262 13:110642766-110642788 GAGTTGGAAGAAAGGGCTGGGGG + Intronic
1113768772 13:112895740-112895762 GAGCTGAAGGAGAGTCCTGAGGG - Intronic
1113772686 13:112920691-112920713 GGGTTGTGGGTGGGTGCTGGTGG + Intronic
1114051412 14:18921772-18921794 GAGTGGTAGGAGGGTGCCCGCGG + Intergenic
1114111149 14:19480153-19480175 GAGTGGTAGGAGGGTGCCCGCGG - Intergenic
1115840172 14:37461426-37461448 GGGTTGTAGGAGGGACCTGGTGG - Intronic
1115883530 14:37946215-37946237 CAGTTGTGGCAGAGTGCTAGTGG - Intronic
1115899538 14:38129512-38129534 GAGTTGTGGGAGGGACCTGGTGG - Intergenic
1115937779 14:38574141-38574163 TAGTTGTAGGAGCTTTCTGGGGG + Intergenic
1115976525 14:39002929-39002951 GATTTGGAGGAGTGGGCTGGGGG - Intergenic
1116347096 14:43807739-43807761 CAGTTCTAGGAGCGTTCTGGAGG - Intergenic
1118069734 14:62232637-62232659 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1118836120 14:69479243-69479265 GTGTTGTGGGAGAGTACTAGTGG - Intergenic
1119045554 14:71315523-71315545 GAGTTGGGGAAGACTGCTGGAGG + Intergenic
1119369834 14:74130117-74130139 GTGTTGTAGGAGAGACCTGGTGG - Intronic
1119621053 14:76132070-76132092 TGGCTGTAGCAGAGTGCTGGGGG + Intergenic
1120285309 14:82493094-82493116 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
1120545418 14:85805545-85805567 TAGTTCTAGGAGATTTCTGGAGG + Intergenic
1120648640 14:87103405-87103427 GTGTTGGAGGAGGGTCCTGGTGG + Intergenic
1120802752 14:88711262-88711284 GTGTTGAAGGAGAGACCTGGTGG + Intronic
1121166368 14:91805966-91805988 GTGTTGTGGGAGAGACCTGGTGG + Intronic
1121267622 14:92614570-92614592 GAGTTGTGGGAGGGACCTGGTGG + Intronic
1122290170 14:100676523-100676545 GAGATGCAGGTGAGTGCTGCAGG - Intergenic
1122344559 14:101050455-101050477 GTGTTGTGGGAGGGTCCTGGTGG + Intergenic
1123893940 15:24809521-24809543 CAGTAGAGGGAGAGTGCTGGTGG - Intergenic
1123928400 15:25142042-25142064 GTGAGATAGGAGAGTGCTGGTGG - Intergenic
1125922058 15:43530743-43530765 GAGTTCTAGCAGGGTCCTGGGGG + Exonic
1127334584 15:57971119-57971141 GAGTCGTGGGTGAGTGGTGGTGG - Intronic
1127683604 15:61320551-61320573 GAGTTGTGGGAGGGACCTGGTGG - Intergenic
1127690279 15:61388771-61388793 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
1127695821 15:61446119-61446141 CAGTTTTAGTAGAGTGCTGGGGG + Intergenic
1127882739 15:63172487-63172509 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1128570405 15:68729516-68729538 GAGTTGTAGGCACGTGCAGGAGG - Intergenic
1130352599 15:83105673-83105695 GAGTTTAAGGAGAGTGGTGAAGG + Intergenic
1130645981 15:85727508-85727530 CAGTTGCAGAAGACTGCTGGTGG + Intronic
1131170510 15:90174848-90174870 GAGTTGTCAGGGAGGGCTGGAGG + Intronic
1131726867 15:95235769-95235791 ATGTTGTAGGAGGGTCCTGGAGG - Intergenic
1132415273 15:101614727-101614749 GATGTGTAGGAGAGTCCTGAAGG - Intergenic
1134022048 16:10928134-10928156 GAGGTGTGGGAGAGTACAGGCGG - Exonic
1134165727 16:11927768-11927790 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1134252302 16:12582925-12582947 GAGTTGGAGGAGGGTGGCGGAGG - Intergenic
1134494996 16:14725972-14725994 GAGTTGGAGGAGGTGGCTGGTGG - Exonic
1134500380 16:14765092-14765114 GAGTTGGAGGAGGTGGCTGGTGG - Exonic
1134526921 16:14951704-14951726 GAGTTGGAGGAGGTGGCTGGTGG - Exonic
1134545483 16:15104647-15104669 GAGTTGGAGGAGGTGGCTGGTGG + Intronic
1134580199 16:15363958-15363980 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1134714498 16:16350181-16350203 GAGTTGGAGGAGGTGGCTGGTGG - Intergenic
1134722373 16:16393545-16393567 GAGTTGGAGGAGGTGGCTGGTGG - Exonic
1134945054 16:18318324-18318346 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1134952318 16:18358477-18358499 GAGTTGGAGGAGGTGGCTGGTGG + Intergenic
1135098712 16:19587214-19587236 GTGTTGGAGGAAAGGGCTGGTGG - Intronic
1135290058 16:21228598-21228620 GAGTTTTAGGACAGTGCAGGAGG + Intergenic
1135311119 16:21405182-21405204 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1135364071 16:21837633-21837655 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1135447771 16:22533715-22533737 GAGTTGGAGGAGGTGGCTGGTGG - Exonic
1135668245 16:24353559-24353581 GAGTCGAAGCAGAGTCCTGGAGG - Intronic
1135681995 16:24465370-24465392 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1136150272 16:28343077-28343099 GAGTTGGAGGAGGTGGCTGGCGG + Exonic
1136166511 16:28456915-28456937 GAGTTGGAGGAGGTGGCTGGCGG + Exonic
1136196463 16:28658117-28658139 GAGTTGGAGGAGGTGGCTGGCGG - Exonic
1136212803 16:28772242-28772264 GAGTTGGAGGAGGTGGCTGGCGG - Exonic
1136257528 16:29052161-29052183 GAGTTGGAGGAGGTGGCTGGCGG - Exonic
1136307823 16:29384178-29384200 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1136321239 16:29485722-29485744 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1136435919 16:30225692-30225714 GAGTTGGAGGAGGTGGCTGGTGG + Exonic
1137384683 16:48030503-48030525 GCGTTGGAGGATAGTTCTGGTGG - Intergenic
1137822742 16:51461435-51461457 GTGTCAGAGGAGAGTGCTGGAGG - Intergenic
1137847377 16:51704271-51704293 AAGTTGGAGGAGAGACCTGGTGG + Intergenic
1139855513 16:69976621-69976643 GAGTTGGAGGAGGTGGCTGGCGG + Intergenic
1140026184 16:71292413-71292435 ATGTTGTGGGAGAGAGCTGGTGG - Intergenic
1140245944 16:73249580-73249602 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
1140258793 16:73359368-73359390 GAGTGGAAGGTGAGTACTGGGGG + Intergenic
1140367220 16:74391480-74391502 GAGTTGGAGGAGGTGGCTGGCGG - Exonic
1141728236 16:85804772-85804794 CAGTTGCAGGAGTGTGGTGGAGG - Intronic
1142034669 16:87855712-87855734 GTGTTGGAGGAGAGGGGTGGGGG + Intronic
1142446973 16:90146851-90146873 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1142448569 16:90159638-90159660 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1142458916 17:75651-75673 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1142460519 17:88480-88502 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1142938872 17:3363991-3364013 GAATTGGAGGAGAGGCCTGGTGG - Intergenic
1143056567 17:4167008-4167030 CTGCTGTTGGAGAGTGCTGGAGG - Exonic
1143397719 17:6615763-6615785 GAGTTTGAGGACACTGCTGGTGG + Intronic
1143845583 17:9770816-9770838 GAGGTGCAGGGGAGAGCTGGGGG + Intergenic
1144004172 17:11085266-11085288 GAATTGTAGGAGGGGCCTGGTGG + Intergenic
1146524126 17:33551650-33551672 AAGTTTTTGGAGAGAGCTGGGGG - Intronic
1146579328 17:34022865-34022887 GTGTTGGAGGAGGGTCCTGGTGG + Intronic
1148897635 17:50849033-50849055 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1149342548 17:55701476-55701498 GTGTTGGAGGAGAGACCTGGTGG - Intergenic
1149485727 17:57041426-57041448 GGGTTGTGGGAGAAAGCTGGTGG - Intergenic
1150945140 17:69737408-69737430 GAGTTCTAGGAGCTTTCTGGTGG + Intergenic
1151195032 17:72425257-72425279 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1151446791 17:74171552-74171574 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1151560150 17:74865694-74865716 GAGTGGTAGGTCAGGGCTGGCGG - Intronic
1152602673 17:81272669-81272691 GCTTTCTAGGAGAGTGGTGGAGG - Intronic
1153583016 18:6594358-6594380 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1154116984 18:11619808-11619830 GAGTTGGAGGAGGTGGCTGGCGG + Intergenic
1155233278 18:23794486-23794508 GAGTGGTAGGAGTGGGCTGGGGG - Intronic
1155262680 18:24060022-24060044 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
1155329068 18:24696256-24696278 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1155447061 18:25923223-25923245 GAGCTGTTGGTGGGTGCTGGAGG - Intergenic
1155812722 18:30258784-30258806 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG + Intronic
1157946921 18:51990983-51991005 AGTTTGTAGGAGGGTGCTGGAGG - Intergenic
1157973240 18:52295322-52295344 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
1158149179 18:54347906-54347928 GTGTTGTAGGAGAGACCTGGTGG + Intronic
1158338472 18:56439055-56439077 CAGTTATAGGAGATTTCTGGAGG - Intergenic
1158591184 18:58780328-58780350 GAGTTGGAGGAGGGGCCTGGTGG - Intergenic
1159220724 18:65460270-65460292 GAGTTGTTGCAAAGTGGTGGGGG - Intergenic
1159528029 18:69618741-69618763 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
1160648635 19:208164-208186 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1160650234 19:220980-221002 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1160827024 19:1085337-1085359 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
1161977347 19:7613772-7613794 GGGTGGTAGGAGCGTGCTGGGGG - Intronic
1162140103 19:8580485-8580507 GAGGGGTAGGGCAGTGCTGGGGG + Exonic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1163539512 19:17899063-17899085 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
1163570941 19:18081984-18082006 GAGTTGGAGGATTGTGGTGGGGG - Intronic
1164439680 19:28264009-28264031 GTGTTGGAGGAGAGAGATGGTGG - Intergenic
1164541596 19:29125630-29125652 GTGTTGTAGGAGGGATCTGGTGG - Intergenic
1164831464 19:31324636-31324658 GAGTTGGTGCAGAATGCTGGTGG - Intronic
1165180393 19:33962480-33962502 GTGTTGGAGGAGGGTCCTGGTGG + Intergenic
1167178151 19:47880362-47880384 GTGTTGTAGGAGGGACCTGGTGG - Intronic
924978924 2:202671-202693 GAGTTGGAGGAGGGTCCTGGTGG + Intergenic
925847968 2:8050869-8050891 GTGTTGAAGGAGGGTCCTGGTGG + Intergenic
927033330 2:19145415-19145437 GTGTTGTGGGAGGGTCCTGGTGG - Intergenic
927302958 2:21536707-21536729 GAATTGGAGGAGAGGCCTGGTGG + Intergenic
927683495 2:25155267-25155289 GGGTTGTAGGAGAGTGGGGAGGG + Exonic
928218304 2:29380826-29380848 GTGTTGGAGGAGGGGGCTGGTGG - Intronic
928541116 2:32284397-32284419 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
928731597 2:34238380-34238402 GGGTTGTGGGAGAGACCTGGTGG + Intergenic
928821895 2:35371698-35371720 GTGTTGGAGGAGGGTCCTGGTGG + Intergenic
929086381 2:38171474-38171496 GAGCTGTAGGAGGGAGCTGAGGG + Intergenic
930934315 2:56929137-56929159 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
931732385 2:65164819-65164841 GAGTTGCAGAAGAGAGCTGGGGG + Intergenic
931882770 2:66583460-66583482 GAGTGGTCGCAGAGTGCAGGTGG - Intergenic
932154826 2:69406843-69406865 GTGTTGTGGGAGGGAGCTGGTGG + Intronic
932299943 2:70659596-70659618 TAGTTATAGGAGAGTGGAGGGGG + Exonic
933006585 2:77003401-77003423 GTGTTGTAGGAGGGACCTGGTGG + Intronic
933046046 2:77538811-77538833 GTGTTGGAGGAGAGACCTGGTGG + Intronic
933231781 2:79816135-79816157 CAGTTCTAGGAGCTTGCTGGAGG + Intronic
933382465 2:81566888-81566910 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
935749244 2:106215748-106215770 GTGTTTTAGGGGAGTACTGGAGG + Intergenic
935854220 2:107257479-107257501 GACTTGTAGGAGGGTGAAGGTGG + Intergenic
936078558 2:109417270-109417292 GAGGTGTAGGTGGGGGCTGGAGG - Intronic
936315712 2:111422558-111422580 GAGTTGGTGGCGAGGGCTGGAGG + Intergenic
937008782 2:118542999-118543021 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
937529682 2:122812927-122812949 CAGTTCTAGGAGTGTTCTGGAGG - Intergenic
938287046 2:130127691-130127713 GAGTGGTAGGAGGGTGCCCGCGG - Intronic
938294987 2:130172379-130172401 GGGCTGGAGGAGAGTGGTGGGGG + Exonic
938428547 2:131211179-131211201 GAGTGGTAGGAGGGTGCCCGCGG + Intronic
938469449 2:131545197-131545219 GAGTGGTAGGAGGGTGCCTGCGG + Intergenic
939224876 2:139352714-139352736 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
939278344 2:140030749-140030771 GTGTTGTGGGAGAGATCTGGTGG + Intergenic
939667702 2:144970716-144970738 GTGTTGTGGGAGGGTCCTGGTGG - Intergenic
942250332 2:174042191-174042213 GAGTTGTAGGAGGGACCTGATGG - Intergenic
942308247 2:174629594-174629616 AAGTTTTAGGAGAGGTCTGGTGG + Intronic
942501895 2:176599921-176599943 GTGTTGGAGGAGGGTCCTGGTGG + Intergenic
942935151 2:181546931-181546953 GTGTTGTGGGAGAGACCTGGTGG + Intronic
942949944 2:181711129-181711151 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
943219150 2:185082441-185082463 GCGTTGAAGGAGGGTCCTGGTGG + Intergenic
943283947 2:185972730-185972752 GAGCTGGAGGAGGGTTCTGGTGG + Intergenic
944299530 2:198107283-198107305 GTGTTGTAGGAGGGACCTGGTGG - Intronic
944364675 2:198903991-198904013 GAGAAGTAGGAGAGAGGTGGAGG - Intergenic
944386258 2:199168288-199168310 GAGTTGTGGGAGGGACCTGGTGG + Intergenic
944418704 2:199505330-199505352 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
944800303 2:203232009-203232031 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
945034319 2:205691220-205691242 GAGATGTGTGAGAGTTCTGGAGG - Intronic
945866054 2:215177163-215177185 GTGTTGGAGGAGAGGCCTGGAGG + Intergenic
946205141 2:218100495-218100517 GTGTTGGAGGAGGGAGCTGGTGG - Intergenic
946228857 2:218279420-218279442 GAGTGGGAGGAAAGTACTGGGGG - Intronic
947239057 2:227974584-227974606 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
947908421 2:233784521-233784543 GAGTTGGAGGTGAGGCCTGGAGG + Intronic
948207509 2:236170004-236170026 GAGGAGGAGGAGAGGGCTGGCGG - Intergenic
1169676556 20:8160659-8160681 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1169808095 20:9580191-9580213 GAGTTGTAGGAGTGTCCTTGGGG + Exonic
1170834491 20:19872028-19872050 GTGTTGAAGGAGGGAGCTGGTGG + Intergenic
1170947033 20:20900668-20900690 GAGGTGAAGGAGCGAGCTGGAGG - Intergenic
1171258603 20:23710967-23710989 GACTTGGAGGAGGGGGCTGGTGG + Intergenic
1171265921 20:23772429-23772451 GACTTGGAGGAGGGGGCTGGTGG + Intergenic
1171505305 20:25628255-25628277 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1172813126 20:37664929-37664951 GTGTTGTGGGAGTGAGCTGGTGG - Intergenic
1173944973 20:46943258-46943280 TTGTTGTTGGTGAGTGCTGGGGG - Intronic
1174580566 20:51568559-51568581 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1174917262 20:54666561-54666583 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
1175072397 20:56345413-56345435 AAGTTGTTGGGGAGTGGTGGGGG + Intergenic
1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG + Intergenic
1176343099 21:5716196-5716218 GAGGGGAAGGTGAGTGCTGGGGG + Intergenic
1176475353 21:7148347-7148369 GAGGGGAAGGTGAGTGCTGGGGG + Intergenic
1176501728 21:7608260-7608282 GAGGGGAAGGTGAGTGCTGGGGG - Intergenic
1176537420 21:8114265-8114287 GAGGGGAAGGTGAGTGCTGGGGG + Intergenic
1176808414 21:13514687-13514709 GAGTGGTAGGAGAGTGTCTGCGG - Intergenic
1177505016 21:22008371-22008393 AATTTGAAGGTGAGTGCTGGAGG - Intergenic
1177867622 21:26531420-26531442 GTGTTGAAGGAGAATCCTGGTGG + Intronic
1177869714 21:26556758-26556780 GTGTTGTAGGAGGGGCCTGGTGG - Intronic
1178037286 21:28599496-28599518 GAGTTGTGGGAGGGACCTGGTGG - Intergenic
1178630106 21:34252118-34252140 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1179096546 21:38321146-38321168 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1179118488 21:38519505-38519527 GAGTAGGAGGAGAGAGCTTGGGG - Intronic
1179299657 21:40095259-40095281 GTGTTGTGGGAGAGACCTGGTGG - Intronic
1180469885 22:15644147-15644169 GAGTGGTAGGAGGGTGCCCGCGG + Intergenic
1180708769 22:17825687-17825709 GAGTTGTCAGACACTGCTGGAGG - Intronic
1181161822 22:20964246-20964268 AAATTGTAGGAGGGTGGTGGTGG + Intergenic
1181289470 22:21780453-21780475 GTGTTTTCGGAGAGAGCTGGTGG - Intronic
1181960533 22:26618937-26618959 GACCTGGAGGACAGTGCTGGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182528050 22:30933904-30933926 GAGTTGGTGCAGACTGCTGGTGG + Intronic
1183087434 22:35495142-35495164 GTGCTGTAGGAGAATGGTGGAGG + Intergenic
1183690110 22:39383498-39383520 GAGGTATGGGAGAGCGCTGGGGG + Exonic
1183692449 22:39398383-39398405 GAGTTGGAGGAGAGAGATGAAGG - Intergenic
1203242363 22_KI270733v1_random:30621-30643 GAGGGGAAGGTGAGTGCTGGGGG + Intergenic
1203324979 22_KI270738v1_random:4862-4884 GAGAAGAAGGAGAGTGGTGGCGG - Intergenic
949221484 3:1639282-1639304 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
949232950 3:1773041-1773063 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
949571509 3:5297990-5298012 GTATTATAGGAGAGAGCTGGAGG + Intergenic
949749970 3:7340528-7340550 GTGTTGAAGGAGAGACCTGGTGG - Intronic
949857051 3:8471406-8471428 GAGGTGAAGGATAGTGCTGTTGG + Intergenic
951242667 3:20305244-20305266 CTGTTGTAGGAGAGACCTGGTGG - Intergenic
951328530 3:21336072-21336094 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
951444005 3:22755750-22755772 CAGTTCTAGGAGATTTCTGGAGG - Intergenic
951463308 3:22974429-22974451 CAGTTGTAGGAGCTTTCTGGAGG - Intergenic
951640540 3:24830047-24830069 GAGTTGGAGAAGAGTACTAGGGG + Intergenic
952200610 3:31123423-31123445 GAGATGGAGGAGATTGGTGGAGG + Intergenic
953268817 3:41419621-41419643 GAGTTTCTGCAGAGTGCTGGTGG - Intronic
953360655 3:42293316-42293338 ATGTTGTAGGAGAGACCTGGTGG + Intergenic
954138064 3:48591374-48591396 GTGTGGAAGGAGAGGGCTGGAGG + Intronic
954578649 3:51691099-51691121 CAGGTCTAGGAGACTGCTGGGGG + Intronic
954895512 3:53971777-53971799 GTGTTGTGGGAGGGTCCTGGTGG + Intergenic
955058500 3:55476297-55476319 GACTTGAAGGTGTGTGCTGGTGG + Intronic
955523874 3:59801683-59801705 GAGTTGTTGGAAGGAGCTGGTGG - Intronic
955765895 3:62343573-62343595 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
956030165 3:65028658-65028680 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
956115740 3:65916604-65916626 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
957871069 3:86091125-86091147 GTGTTGAGGGAGGGTGCTGGTGG + Intergenic
957958546 3:87220527-87220549 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
957987627 3:87591462-87591484 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
958569512 3:95861276-95861298 GATCTGTAGGAGTTTGCTGGAGG - Intergenic
958630099 3:96673224-96673246 GAGGTGGAGGAGAGAGATGGAGG - Intergenic
958630113 3:96673338-96673360 GAGATGGAGGAGAGAGATGGAGG - Intergenic
958710477 3:97711063-97711085 GTGTTGTGGGAGGGAGCTGGTGG + Intronic
958740113 3:98058827-98058849 GTGTTGCAGGAGAGGCCTGGTGG - Intergenic
959998426 3:112704004-112704026 GAGTTCTAGGAGCTTTCTGGAGG - Intergenic
960261071 3:115568892-115568914 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
960381585 3:116969505-116969527 GAGTTGCGGGAGGGAGCTGGTGG + Intronic
960626673 3:119687987-119688009 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
961068038 3:123892668-123892690 GAATTGGAGGAGGGGGCTGGTGG - Intergenic
961624602 3:128253219-128253241 GAGTTGTAGGAACGTGCATGGGG - Intronic
962328129 3:134452939-134452961 GTGTTGGAGGAGAGACCTGGTGG - Intergenic
962672752 3:137726020-137726042 GTGTTGTAGGAGGGACCTGGGGG - Intergenic
963458600 3:145577975-145577997 GACTTGTAGGAGAGAGATGAAGG - Intergenic
963572683 3:147016904-147016926 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
964768977 3:160204658-160204680 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
964781019 3:160338163-160338185 GAGTTCTAGGATATTGCTGGTGG - Intronic
964943708 3:162191615-162191637 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
965203771 3:165693991-165694013 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
965446089 3:168776363-168776385 ATGTTGTAGGAGGGAGCTGGTGG + Intergenic
965629358 3:170715663-170715685 GAGTTGTGTGAGAGACCTGGTGG - Intronic
965838670 3:172879417-172879439 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
966452460 3:180077818-180077840 GTGTTGAAGGAGGGGGCTGGTGG - Intergenic
966513766 3:180794190-180794212 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
966824872 3:183955023-183955045 GAGTGGTGGGGGAGTGGTGGGGG + Intronic
968037956 3:195564250-195564272 GAGTTGTTAGAGAGATCTGGTGG + Intergenic
968367612 3:198199149-198199171 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
968369214 3:198211951-198211973 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
968783295 4:2599521-2599543 CAGTTGTAGGAGAATATTGGTGG + Intronic
970224996 4:13848766-13848788 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
970756969 4:19438139-19438161 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
970787535 4:19817008-19817030 GAGTTAAAAGAGAGTGCTGCTGG - Intergenic
971533143 4:27714574-27714596 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
971896566 4:32604753-32604775 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
971970166 4:33609158-33609180 GAGGTGCAGCAGAGTGCTAGTGG - Intergenic
972046101 4:34666382-34666404 GTGTTGTGGGAGGGTCCTGGTGG + Intergenic
972774403 4:42227986-42228008 GTGTTGGAGGAGAGGACTGGTGG + Intergenic
973840079 4:54852381-54852403 AAATAGGAGGAGAGTGCTGGAGG + Intergenic
974171479 4:58271543-58271565 GTGTTGTAGGAGAGACCTGGTGG + Intergenic
974573379 4:63685160-63685182 GTGTTGTAGGAGAGACCTGGTGG + Intergenic
974868999 4:67615131-67615153 GTGTTGGAGGTGAGGGCTGGTGG + Exonic
975019646 4:69470706-69470728 GAGTTGTGGGAAGGTGCTGGTGG - Intergenic
975410128 4:74039021-74039043 GGGTTGGAGGAAAGAGCTGGGGG + Intergenic
975467464 4:74724700-74724722 GAGTTGTGGGAGGGGCCTGGTGG - Intergenic
976556546 4:86457417-86457439 GAGTTCTAGGAGCTTTCTGGAGG - Intronic
976614779 4:87065359-87065381 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
976675939 4:87703534-87703556 GAATTGGAAGAGATTGCTGGTGG - Intergenic
976685974 4:87815572-87815594 GAGTTCTAGGAGCTTTCTGGAGG + Intergenic
977122173 4:93115848-93115870 GTGTTGTAGGAGGGACCTGGGGG - Intronic
977474268 4:97485318-97485340 GAGTTCTAGGAGCTTTCTGGAGG - Intronic
977612704 4:99052639-99052661 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
977984073 4:103361093-103361115 GTGTTGGAGGAGGGGGCTGGTGG + Intergenic
978251581 4:106637406-106637428 GTGTTGGAGGAGAGACCTGGTGG + Intergenic
978501233 4:109412052-109412074 GTGTGGTAGGAGAGAGCTTGTGG + Intergenic
979225051 4:118275353-118275375 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
979256027 4:118608861-118608883 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
979257639 4:118621679-118621701 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
979330708 4:119418883-119418905 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
979332317 4:119431676-119431698 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
980153581 4:129079084-129079106 GTGTTGGAGGAGAGCCCTGGTGG - Intronic
980984713 4:139684308-139684330 GTGTTGTAGGAGGGACCTGGTGG - Intronic
981760756 4:148192491-148192513 CAGTTGTAGTAGTGTGCTGAGGG + Intronic
982470858 4:155788339-155788361 GAGATGTAGGAGACTGTTGAAGG - Intronic
982886500 4:160788735-160788757 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
982993800 4:162315683-162315705 ATGTTGTAGGAGGGTCCTGGTGG - Intergenic
983460838 4:168024043-168024065 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
983812196 4:172076870-172076892 GAATTGGAGGAGAGACCTGGTGG + Intronic
984563433 4:181298571-181298593 CAGTTGTAGGAGCTTTCTGGAGG + Intergenic
985894863 5:2743070-2743092 GAGTGGTGGGAGAGGGCTCGGGG - Intergenic
986123440 5:4864412-4864434 GAATTGGAGGAGGGTCCTGGTGG - Intergenic
986424337 5:7615183-7615205 GTGTTGAAGGAGGGGGCTGGTGG - Intronic
986950064 5:13072114-13072136 GTGTTGAAGGAGAGGCCTGGTGG - Intergenic
987465658 5:18269093-18269115 GTGTTGTGGGAGGGTCCTGGTGG + Intergenic
987651009 5:20739894-20739916 GTGTTGTGGGAGGGAGCTGGTGG + Intergenic
987680894 5:21134296-21134318 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
988687693 5:33540705-33540727 GAGCTGTTGGAGTTTGCTGGAGG - Intronic
988744553 5:34121569-34121591 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
990775790 5:59304276-59304298 CAGTTCTAGGAGCTTGCTGGAGG + Intronic
992125569 5:73636571-73636593 GAGTTGGAAGTGATTGCTGGTGG + Intronic
993442563 5:87974486-87974508 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
993523480 5:88934816-88934838 GAGATGGAGGAGAGAGATGGTGG - Intergenic
993872542 5:93268970-93268992 GAGAGGTAGAAGAGAGCTGGTGG - Intergenic
994019412 5:95005500-95005522 GTGTTGAAGGAGGGAGCTGGTGG + Intronic
995199890 5:109414023-109414045 GTGTTGTAGGAGGGATCTGGTGG + Intergenic
995437931 5:112158801-112158823 GTGTTGTGGGAGGGAGCTGGTGG - Intronic
995796803 5:115949914-115949936 GAGTTGTAGGGCAATGCTGATGG + Intergenic
995946879 5:117658659-117658681 GAAGTGTAGGAGAATGTTGGAGG + Intergenic
996046002 5:118873948-118873970 CAGTTGCAACAGAGTGCTGGTGG - Intronic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
996404564 5:123093033-123093055 GAGTTGTATGTGAGTGGAGGTGG + Intronic
996622228 5:125520869-125520891 ATGTTGTAGGAGAGACCTGGTGG - Intergenic
997036979 5:130204028-130204050 GTGTTGTAGGAGGGAACTGGTGG - Intergenic
997076888 5:130689552-130689574 GAGTGGACGGAGAGGGCTGGTGG - Intergenic
997492210 5:134286805-134286827 GTGTTGTAGGAGGGACCTGGTGG - Intronic
998964707 5:147526724-147526746 GAGTTGGAAGAGGGGGCTGGAGG + Intergenic
999204345 5:149837244-149837266 CAGTTGTGGGTGAGTTCTGGAGG + Intronic
999616871 5:153434164-153434186 GAGGTGGAGGGGACTGCTGGAGG - Intergenic
1000034672 5:157436141-157436163 GTGTTGTAGGAGGGACCTGGTGG + Intronic
1000728652 5:164803060-164803082 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
1001496248 5:172189213-172189235 GAATCTAAGGAGAGTGCTGGGGG + Intergenic
1002187376 5:177460630-177460652 GAGGTGGAGGTGAGAGCTGGGGG - Exonic
1002726835 5:181304378-181304400 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1002728492 5:181317536-181317558 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1003621542 6:7705193-7705215 GAATTGAAGGAAAGTGGTGGTGG + Intergenic
1003714985 6:8636079-8636101 GAGGTCTAGGGGAGTGGTGGTGG + Intergenic
1004258125 6:14083851-14083873 GGGCTGGGGGAGAGTGCTGGTGG - Intergenic
1005984585 6:30863188-30863210 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1006298623 6:33181298-33181320 GAGTTTTAGGGGAGGGCTGTGGG - Intronic
1006910825 6:37562458-37562480 TGGTTCTAGGAGGGTGCTGGGGG + Intergenic
1007152639 6:39709483-39709505 CAGTAGGAGGTGAGTGCTGGTGG - Intronic
1007381481 6:41492901-41492923 GAGGTGGGAGAGAGTGCTGGGGG - Intergenic
1007766817 6:44165622-44165644 GAGGTTGAGGAGACTGCTGGAGG + Intronic
1007844206 6:44740342-44740364 TATTTGTATGTGAGTGCTGGCGG + Intergenic
1008004523 6:46396397-46396419 GAGTTGGAGGTGAGGGCTAGAGG + Intronic
1010645986 6:78387993-78388015 GTGTTGTAGGAGGGTCCCGGTGG - Intergenic
1010835952 6:80587415-80587437 GTGTCGTAGGTGAGTTCTGGTGG + Intergenic
1011287709 6:85742992-85743014 CAGTTCTAGGAGATTTCTGGAGG + Intergenic
1011862220 6:91773538-91773560 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1012092567 6:94918085-94918107 GAATTGGAGGAGACTCCTGGTGG + Intergenic
1012183169 6:96180621-96180643 TAGAGGTAGGAGAGTGTTGGTGG - Intronic
1012278062 6:97297301-97297323 GCGTTGTGGGAGAGCCCTGGTGG - Intergenic
1013378182 6:109539841-109539863 GATTTGTTGGAGTTTGCTGGGGG + Intronic
1013419338 6:109951791-109951813 GGGTTGGAGGAGAGGCCTGGTGG + Intergenic
1014400743 6:120987031-120987053 GTGTTGTAGGAGGGACCTGGTGG - Intergenic
1016189396 6:141244420-141244442 TTGTTGTAGCAGTGTGCTGGAGG + Intergenic
1016520814 6:144944635-144944657 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1016572112 6:145525676-145525698 GAGTTCTAGGAGACTTTTGGTGG + Intronic
1016594239 6:145781441-145781463 AAGTTGGAGGAGAGAACTGGAGG + Intergenic
1017458458 6:154624789-154624811 GAGTTGTGGGAGGGACCTGGTGG + Intergenic
1017495570 6:154980186-154980208 GAGTTGTATGAGTTTGCTAGGGG - Intronic
1017495655 6:154980941-154980963 GAGTTGTATGAGTTTGCTAGGGG - Intronic
1018705097 6:166458225-166458247 GTGTTGTAGGAGGGACCTGGTGG + Intronic
1018721423 6:166575969-166575991 GTGTTGTAGGAGGGACCTGGTGG + Intronic
1018854552 6:167666291-167666313 GATGTGTAGGTGAGGGCTGGGGG - Intergenic
1018914225 6:168122940-168122962 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1019093862 6:169563233-169563255 GAGTTGCAGGAAAGAGGTGGAGG - Intronic
1019789650 7:3002787-3002809 GTGTTGGAGGAGGGTCCTGGTGG - Intronic
1020093927 7:5357149-5357171 AAGTTTTCGGACAGTGCTGGGGG - Exonic
1021066786 7:16185345-16185367 GTGTTGTGGGAGGGTCCTGGTGG - Intronic
1021363987 7:19753307-19753329 GAGTGGGAGTAGGGTGCTGGTGG - Intronic
1022488361 7:30797816-30797838 CAGTAGTAGAAGAGAGCTGGTGG + Intronic
1022499668 7:30874525-30874547 GGGTTGCAGGTGACTGCTGGAGG + Intronic
1023398157 7:39771229-39771251 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1024441288 7:49421401-49421423 GAGTGGTAGGAAGGTGCTGGGGG + Intergenic
1024650773 7:51401440-51401462 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1025054894 7:55757020-55757042 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1025132967 7:56387246-56387268 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1025134502 7:56399266-56399288 GAGTTGTATGAGAGTGGGGAGGG - Intergenic
1025159078 7:56637152-56637174 CAGCTGTAGCAGAGTGCTAGTGG - Intergenic
1025911024 7:65828820-65828842 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1025939266 7:66062206-66062228 GTGTTGGGGGAGAGAGCTGGTGG - Intergenic
1026044071 7:66893590-66893612 GAGTTGTATGAGAGTGAGGAGGG + Intergenic
1026207404 7:68270078-68270100 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
1027350007 7:77302062-77302084 CAGTTCTAGGAGATTTCTGGAGG + Intronic
1027690488 7:81338695-81338717 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
1028185553 7:87781367-87781389 CAGTTCTAGGAGCCTGCTGGTGG + Intronic
1028192496 7:87869122-87869144 GAGTTCTGGGATATTGCTGGTGG + Intronic
1029060919 7:97797240-97797262 GTGTTGGAGGAGGGTCCTGGTGG - Intergenic
1030423298 7:109337623-109337645 GAGATTTAGGAGAATACTGGTGG + Intergenic
1030443584 7:109620723-109620745 TAGTTTTAGGAGATTTCTGGGGG + Intergenic
1031583358 7:123504697-123504719 GTGTTGGAGGAGAGGTCTGGTGG - Intronic
1031760908 7:125712085-125712107 CAGTTCTAGGAGATTTCTGGAGG + Intergenic
1032048345 7:128629597-128629619 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1032049946 7:128642420-128642442 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1032887614 7:136158521-136158543 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1034077217 7:148243685-148243707 GTGTTGTGGGAGAGACCTGGTGG - Intronic
1034376778 7:150652360-150652382 CAGTTCTAGGAGATTTCTGGAGG + Intergenic
1035788508 8:2282084-2282106 TACATCTAGGAGAGTGCTGGAGG - Intergenic
1035804297 8:2439621-2439643 TACATCTAGGAGAGTGCTGGAGG + Intergenic
1037181988 8:16018335-16018357 CTTTTGTAGGAGAGTGGTGGTGG - Intergenic
1037257255 8:16969361-16969383 GTGTTGTGGGAGAGATCTGGTGG + Intergenic
1037354661 8:18005116-18005138 GAGCTGTAGGAGCATACTGGAGG - Intronic
1037445674 8:18963214-18963236 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1038953010 8:32436297-32436319 GTGTTGTAGGAGGGACCTGGTGG - Intronic
1039474290 8:37831341-37831363 GTGTTGTAGGACGGTGCTGAGGG + Intronic
1039728017 8:40242532-40242554 CAGTTCTAGGAGATTTCTGGAGG - Intergenic
1041013650 8:53569707-53569729 GTGTTGGAGGACAGTCCTGGTGG + Intergenic
1041877616 8:62708602-62708624 CAGTTCTAGGAGCTTGCTGGAGG + Intronic
1042190505 8:66180951-66180973 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
1043591281 8:81836032-81836054 GTGTTGTGGGAGAGACCTGGTGG - Intronic
1043830505 8:84982832-84982854 GAGTTTTTGTAAAGTGCTGGCGG + Intergenic
1044004156 8:86921716-86921738 GTGTTGTAGGAGAGACCTGGTGG - Intronic
1045674680 8:104593898-104593920 GTGTTGGAGGAGAGGCCTGGAGG + Intronic
1046517355 8:115280610-115280632 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1046563460 8:115868623-115868645 GTGTTGTAGGAGTGACCTGGGGG + Intergenic
1047301571 8:123617993-123618015 AAGGGTTAGGAGAGTGCTGGGGG + Intergenic
1047417668 8:124678650-124678672 GAGTTGTGGGAGGGACCTGGTGG - Intronic
1047619440 8:126591368-126591390 TAGTTGGAGCAGAGTGTTGGAGG + Intergenic
1048023230 8:130559935-130559957 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1048030575 8:130627894-130627916 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1048111211 8:131470934-131470956 GTGTTGAGGGAGAGAGCTGGTGG + Intergenic
1048462115 8:134629520-134629542 GAATTGGAGGAGAGGCCTGGTGG + Intronic
1049489834 8:142890066-142890088 GTGTTGGAGGAGGGTCCTGGTGG - Intronic
1050052390 9:1616721-1616743 GAGTTGCAGGAGAGTTCTCCAGG - Intergenic
1050360989 9:4830959-4830981 TAGTTTTAGCAGAGTGATGGTGG - Intronic
1050644524 9:7704426-7704448 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
1050742648 9:8840233-8840255 GTGTTGTAGGAGATACCTGGTGG + Intronic
1050999354 9:12261079-12261101 GTGTTGTGGGAGAGTGGAGGAGG - Intergenic
1051893765 9:21968387-21968409 GAGGTGTGGGAGAGCGGTGGCGG - Intronic
1052638355 9:31131707-31131729 CAGTTCTAGGAGATTTCTGGAGG + Intergenic
1055140115 9:72867590-72867612 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1055568677 9:77594349-77594371 GAGTGGCTGGAGAGTGCTGGTGG - Intronic
1055579496 9:77692566-77692588 GGGTTGTAGGAGGGACCTGGTGG - Intergenic
1056240537 9:84642148-84642170 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1056685431 9:88755056-88755078 GAGCTGTAGGACTTTGCTGGTGG + Intergenic
1056719461 9:89059807-89059829 GTGGTGTAGGACAGTGGTGGAGG + Intronic
1056719480 9:89059895-89059917 GTGGTGTAGGACAGTGGTGGAGG + Intronic
1056900239 9:90592392-90592414 GGGATGAAGGAGGGTGCTGGGGG - Intergenic
1057167584 9:92940915-92940937 GAGGTGGAGCAGAGAGCTGGAGG + Intergenic
1058123741 9:101168082-101168104 GTGTTGTAGGAGGGATCTGGTGG - Intronic
1058622840 9:106901796-106901818 CAGTTCTAGGAGATTTCTGGAGG + Intronic
1059040846 9:110814073-110814095 GTGTTGTGGGAGAGACCTGGTGG - Intergenic
1059410516 9:114129309-114129331 GTGTTGGAGGAGGGTCCTGGTGG - Intergenic
1059617438 9:115966691-115966713 GTGTTGTAGGTGGGTCCTGGTGG - Intergenic
1060136356 9:121159047-121159069 GAGTCGTAGGACAGTGCTATAGG + Intronic
1060757927 9:126226291-126226313 GGGTTCTTGGAGAGTGCTGGGGG - Intergenic
1062039699 9:134398631-134398653 GAGTTGGAGGAGGGGACTGGAGG - Intronic
1062240400 9:135534542-135534564 GAGCAGGAGGAGAGTGCGGGCGG - Intergenic
1062485370 9:136772054-136772076 GAGCTACAGCAGAGTGCTGGTGG - Intergenic
1062751953 9:138261854-138261876 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1062753555 9:138274635-138274657 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1203458691 Un_GL000220v1:13698-13720 GAGGGGAAGGTGAGTGCTGGGGG + Intergenic
1203576067 Un_KI270745v1:9414-9436 GAGTTGTATGAGAGTGGGGAGGG + Intergenic
1186053446 X:5624460-5624482 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1186742749 X:12535008-12535030 ATGTTGTAGGAGAGACCTGGTGG + Intronic
1188327415 X:28822647-28822669 GACTTGTGGGAGATGGCTGGTGG + Intronic
1189088196 X:38048742-38048764 GTGTTGTGGGAGAGACCTGGTGG - Intronic
1189636297 X:43013942-43013964 GTGTTGTAGGAGGGACCTGGTGG + Intergenic
1189704862 X:43749717-43749739 GAGGTGTGGGTGTGTGCTGGGGG + Intergenic
1190013981 X:46810788-46810810 GTGTTGTAGGAGGGGCCTGGTGG - Intergenic
1190506942 X:51135764-51135786 GTGTTGTAGGAGGGAACTGGTGG + Intergenic
1191077678 X:56472728-56472750 AAGTTGGAGGAGAGTCCTGGTGG + Intergenic
1192219733 X:69189454-69189476 GAATTGTAGGCTAGTGCTGAGGG - Intergenic
1192994755 X:76501236-76501258 CAGTTGTAGGAGCTTTCTGGAGG + Intergenic
1193027223 X:76857176-76857198 GTGTTGTGGGAGGGAGCTGGTGG - Intergenic
1193210991 X:78806658-78806680 GTGTTGTGGGAGAGACCTGGTGG + Intergenic
1193915929 X:87363876-87363898 GAATGGTAGTAGAGTGCTGAGGG + Intergenic
1194056579 X:89142214-89142236 GAGTTGCAGGAGAGGGGTGTGGG + Intergenic
1194382966 X:93218230-93218252 GAGATGTAGGAGGGAGTTGGTGG - Intergenic
1194454074 X:94080560-94080582 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1195250768 X:103044374-103044396 TAGTTGCAGGAGAATGCAGGGGG - Intergenic
1196835873 X:119813271-119813293 GTGTTGTAGGTGGGTCCTGGTGG + Intergenic
1196986627 X:121280892-121280914 GAGTTGTGGGAGTGGGTTGGTGG + Intergenic
1197132805 X:123024244-123024266 CAGTTCTAGGAGATTTCTGGAGG - Intergenic
1197873588 X:131082569-131082591 GAGGTATTGGAAAGTGCTGGGGG + Intronic
1199403649 X:147429908-147429930 GTGTTGGAGGAGGGTCCTGGTGG - Intergenic
1199928332 X:152493180-152493202 CAGTTGTAGGAGCTTTCTGGAGG - Intergenic
1199974138 X:152882658-152882680 GAGTTTTAGGAGAGAGATGTAGG - Intergenic
1200035801 X:153329055-153329077 GTGTTGTAGGAGGGACCTGGAGG - Intergenic
1200076113 X:153552020-153552042 GAGTTCTGGGAGAGCGCTGTGGG - Intronic
1200415305 Y:2903688-2903710 CAGTTGTAGGAGCTTTCTGGAGG - Intronic
1201222733 Y:11787871-11787893 GAGTTTTAGGAGAGTTGTTGGGG - Intergenic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic
1201985374 Y:19959447-19959469 GGGTTGTAGGAGATTGGTGAAGG + Intergenic