ID: 1157114597

View in Genome Browser
Species Human (GRCh38)
Location 18:44851255-44851277
Sequence GGCCCAGGAAAGCTTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157114595_1157114597 -6 Left 1157114595 18:44851238-44851260 CCATTTCAGAGAAGGAGGGCCCA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG 0: 1
1: 0
2: 5
3: 63
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157114597 Original CRISPR GGCCCAGGAAAGCTTCCTGT AGG Intronic
900553345 1:3267828-3267850 GAACCAGGGAGGCTTCCTGTGGG - Intronic
900759585 1:4461957-4461979 GGCCCGGTCAACCTTCCTGTGGG + Intergenic
900895447 1:5479965-5479987 TGCCCAGCAGAGCTTCCTGGCGG - Intergenic
900914891 1:5629942-5629964 GGCACATGCAAGATTCCTGTTGG + Intergenic
901737999 1:11324475-11324497 GGGACAGGAAGGCTTCCTGGGGG + Intergenic
902268877 1:15288946-15288968 AGTCCAGGAAGGCTTCCTGGGGG + Intronic
902558179 1:17259473-17259495 GGCCAAGGAAAGCTTCCTGGAGG + Intronic
902634217 1:17724589-17724611 AATCCAGGAAAGCTTTCTGTAGG + Intergenic
902777758 1:18685527-18685549 GGCCCAGGAAGCCTTGCTGGGGG + Intronic
902794473 1:18792223-18792245 GGCTAAGGAAGGCTTCCTGGAGG + Intergenic
902928156 1:19711307-19711329 TGCAAAGGAAAGCTTCTTGTAGG - Intronic
903355727 1:22746274-22746296 GGCCAGGGAAGGCTTCCTGGAGG + Intronic
903376008 1:22866376-22866398 GGCCCAGGAAGTCTTCCTGGAGG + Intronic
903461882 1:23526023-23526045 AGCCCAGGAAGACTTCCTGGAGG - Intronic
903591976 1:24463379-24463401 GGCCCAGGAAAACTTTCTGAGGG + Intronic
903791154 1:25894009-25894031 GGCCCAGGATGAATTCCTGTAGG - Intronic
903845172 1:26275575-26275597 GGCCCAGGAATGCTTTTTGATGG + Intronic
904281015 1:29418275-29418297 GGTTCAGGAAAGCTTCATGGAGG - Intergenic
904595084 1:31639056-31639078 GGTCAAGGAAAGCTTCCTGGAGG + Intronic
905084330 1:35357186-35357208 GGTCCAGGAAAGCTTTCCTTTGG + Intronic
905124882 1:35709260-35709282 GGTCAAGGAAGGCTTCCTGGAGG - Intergenic
905346463 1:37314330-37314352 GGCCAGAGAAAGCTTCCTGAAGG - Intergenic
905432808 1:37936621-37936643 AGCCCAGGAAGGCTTCATGTAGG - Intronic
905536279 1:38724552-38724574 AGCCAAGGGCAGCTTCCTGTTGG + Intergenic
905953710 1:41974678-41974700 GGTTCAGGAAGGCTTCCTGGAGG - Intronic
906069776 1:43008069-43008091 CGCCCAGGAAAGTCTTCTGTGGG + Intergenic
906242669 1:44251588-44251610 AGGCTAGGAAAGCTTCCTGGAGG + Intronic
906264633 1:44418563-44418585 AGCCCCGGAAAACTTCCCGTGGG - Intronic
906626821 1:47332487-47332509 GGCCCAAGAAAGATTGCAGTGGG - Intergenic
906659257 1:47570999-47571021 GGGTCAGGAAAGCTTCCTGGAGG + Intergenic
906686561 1:47766940-47766962 GGCTCAGGTCAGCTTCCAGTTGG - Intronic
907046623 1:51303577-51303599 GGCCTGGGAAGGCTTCCTGGGGG + Intronic
907450657 1:54543681-54543703 GGGCCAAGAAGGCTTCCTGGAGG + Intronic
907476539 1:54709740-54709762 AGTCCAGGAAGGCTTCCTGGAGG + Intronic
907514793 1:54986707-54986729 AACCCAGGAAGGCTTCCTGGAGG + Intronic
907733148 1:57087135-57087157 AACCCATGAAAGCTTGCTGTGGG + Intronic
907752010 1:57271713-57271735 GGTCTAGGAAGGCTTCCTGGAGG + Intronic
912532772 1:110338579-110338601 GTCCCAGGACGGCTTCCTGAGGG + Exonic
912693181 1:111819903-111819925 GGACCAGGAAAGCTTTCCTTGGG + Intronic
912967432 1:114248703-114248725 GCCCCAGGAAAGCTTCACGTTGG + Intergenic
913084774 1:115426521-115426543 AGCCCAGGAAAACTTCCTTCTGG + Intergenic
915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG + Intergenic
915086911 1:153395215-153395237 AACCCAGGAAGGCTTCCTGAGGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
915515637 1:156410915-156410937 AGCTCAGGAAGGCTTCCTGGAGG - Intronic
918404319 1:184196343-184196365 GTTCCAGGAAGGCTTCCTGGAGG + Intergenic
919731700 1:200916946-200916968 GGCCCAGGGAAGCCTGCTGGTGG - Intergenic
919854019 1:201693619-201693641 GGCCAAGGAAGGCTTCTTGGAGG + Intronic
919977712 1:202623481-202623503 GCCCCAGGACAGCTGCCTGTGGG - Intronic
920280319 1:204838622-204838644 GGCCCTGAAAAGCTGGCTGTGGG + Intronic
921017692 1:211207414-211207436 GGCCCAGCAGGGCGTCCTGTTGG - Intergenic
922790414 1:228308016-228308038 TGCCCAGGAAGGCTTCCTGGAGG + Intronic
923104317 1:230842935-230842957 GGGCCAGGGGAGCTGCCTGTTGG - Intronic
1064279240 10:13936174-13936196 AATCCAGGAAAGCTTCCTGGAGG + Intronic
1066537701 10:36409759-36409781 GACCCACTAAAGTTTCCTGTGGG - Intergenic
1067179876 10:43976969-43976991 TGCTCAGGAAATCTTCCTGAGGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067541072 10:47153548-47153570 GACCCTGGAAGGCTTCCTGGAGG - Intergenic
1068909635 10:62365439-62365461 GGACCAGGAAAGCTTCATAATGG + Intergenic
1069374995 10:67784797-67784819 GGCCAAGGAAACATTCCTGAAGG - Intergenic
1069742072 10:70691130-70691152 GGGCCAGGACATCTGCCTGTTGG + Intronic
1069890769 10:71651163-71651185 GGTCCAGGAAAGCTTCCCTGAGG + Intronic
1070736224 10:78865509-78865531 GGCCAAGATAAGCTTCCTCTGGG - Intergenic
1071977030 10:90965302-90965324 GGCCCAGGAAAGGTTATTTTAGG - Intergenic
1072915010 10:99532570-99532592 GGGGCAGGAAAACTTCCTGGCGG - Intergenic
1074084349 10:110196431-110196453 GGCCCAGCAGAGCTCCCTGAAGG + Intergenic
1074932686 10:118145237-118145259 AGCCCAGGAACGCTGGCTGTGGG - Intergenic
1075001873 10:118804750-118804772 GGACCAGGAAGGCTTCCTGGAGG + Intergenic
1076314002 10:129527996-129528018 AGTCCAGGAAGGCTTCCTGGAGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077075370 11:698810-698832 GACCCGGGAAAGCATCCTGGTGG + Intronic
1077366833 11:2164652-2164674 GGTCAAGGAAAGCTTCCTGGAGG - Intronic
1077376563 11:2207965-2207987 GGCCCAGGCACGCTCCCAGTGGG + Intergenic
1077725089 11:4666485-4666507 TGCCCAGTGAAGCTTCCTGCAGG - Intergenic
1078529606 11:12126855-12126877 GGGCCTGGAAAGCTTCCTGGAGG + Intronic
1079241886 11:18727435-18727457 GGCCCAGGGAATCTGCATGTGGG - Intergenic
1080633311 11:34100943-34100965 AGCCCAGGAATTCTTCCAGTAGG + Exonic
1080882961 11:36339832-36339854 AGCCCAAGAAAGCTTCCTAATGG - Intronic
1081190551 11:40099380-40099402 AGCCCAGGAAAGCTTCCTATTGG + Intergenic
1081534648 11:43987934-43987956 GGCCCAGGAAAATTCCCTGCGGG - Intergenic
1083046762 11:59743668-59743690 GGCCCAGCCAAGCTTGCTATTGG - Intronic
1083587477 11:63870752-63870774 GGATCAGGAAAGCTTCCTGGTGG + Intronic
1083630826 11:64094484-64094506 GGGTCAGGGAAGCTTCCTGGAGG + Intronic
1084314625 11:68337910-68337932 GGCCCAGGCAGGCTTCCTGGAGG - Intronic
1084429138 11:69101693-69101715 GGCCCAGGAAGGCTGCCAGGAGG - Intergenic
1084515494 11:69636125-69636147 AGCCCAGGCAGGCATCCTGTTGG + Intergenic
1084942643 11:72621213-72621235 TACCCAGGAAGGCTTCCTGGAGG - Intronic
1085122604 11:73976832-73976854 GGCCCCGGAACCCTTCCTCTCGG + Exonic
1085202850 11:74712271-74712293 GGCCAGGGAAGGCTTCCTGAAGG + Intronic
1086370686 11:86152619-86152641 GGGTCAGGAAGGCTTCCTGTAGG - Intergenic
1088740359 11:112762181-112762203 GGGCCAGGGAAGCTTTCTGCAGG + Intergenic
1089443313 11:118533227-118533249 GGCCCTGCAAAGCTTCAGGTGGG + Intronic
1090620453 11:128556067-128556089 GGCCCAAGAAAGGTTGCTTTAGG - Intronic
1090865725 11:130698893-130698915 GGTCCAGGAAGGCCTCCTGGAGG + Intronic
1091759684 12:3078359-3078381 AGTCCAGGAAAGCTTCCTGGAGG - Intronic
1095051420 12:37557888-37557910 GGCTCCGGTAAGCTTCTTGTTGG + Intergenic
1095054741 12:37585490-37585512 GGCTCAGGTAAGCTTTTTGTTGG + Intergenic
1096584680 12:52612172-52612194 AGCCCTGGAAAGCTGCCTGTGGG - Intronic
1097003241 12:55896261-55896283 GCCCCAGAAAACCTTCCAGTGGG - Intergenic
1097182656 12:57180040-57180062 GGTCCAGTAGAGCTTCCTGGGGG - Exonic
1098578421 12:72070739-72070761 AGCCCAGGAAAGCAGCCTGGAGG - Intronic
1099320133 12:81136504-81136526 GGCCAAAGAAGGCTTCCTGAAGG + Intronic
1099467611 12:83006167-83006189 GGCCAAGGAGTCCTTCCTGTAGG + Intronic
1100396811 12:94193002-94193024 GGTCAAGGAAGGCTTCCTGGAGG + Intronic
1100399946 12:94220769-94220791 GGGTAAGGAAAGCTTCCTGGAGG + Intronic
1101464691 12:104936313-104936335 GGCCCAGGAAACCTTGCAGTGGG + Intronic
1101911354 12:108862420-108862442 GGGCAAGGAAGGCTTCCTGGAGG - Intronic
1102245542 12:111353517-111353539 GGTCCAGGAAGGCTTCCTGGAGG + Intergenic
1102591772 12:113961679-113961701 GAGTCAGGAAAGCTTCCTGGAGG - Intronic
1102643026 12:114383228-114383250 GGCCAGGGAAAGCTTCTTGAAGG + Intronic
1103582019 12:121922511-121922533 GGCCAGGGAAAGCTTCCTGGAGG + Intronic
1103994800 12:124822062-124822084 AGCCCAGGAAGGCTGCCTGGAGG + Intronic
1104057119 12:125239092-125239114 GGTCAGGGAAAGCTTCCTGGAGG + Intronic
1104564727 12:129870470-129870492 GGCTCAGCAGAGCTTCCTGGTGG + Intronic
1104893664 12:132151790-132151812 GGCCTTGGAGAGCTCCCTGTGGG + Exonic
1105831498 13:24166345-24166367 GATCCAGGAAGGCTTCCTGGAGG + Intronic
1105930411 13:25047199-25047221 CGCCCAGGACAGTTTCCCGTCGG - Intergenic
1106370340 13:29126711-29126733 GGCCCAGGGAAGCTACATATTGG + Intronic
1110923567 13:81120560-81120582 GGCCAGGAAAAGCTTCCTGGAGG - Intergenic
1111993236 13:95137624-95137646 CCACCAGGAAAGCTTCCTGTGGG - Intronic
1112567146 13:100561505-100561527 TGTCCAGGAAAGCCTTCTGTGGG - Intronic
1112746861 13:102536606-102536628 GGCCCAGATGAGCTTCCTCTGGG - Intergenic
1113311659 13:109139290-109139312 GGCATATGAAAGCTTACTGTCGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG + Intergenic
1116780909 14:49236592-49236614 AGCCCATGAAAGCATCCTGGAGG + Intergenic
1118312511 14:64704358-64704380 GGGCCAGGAATTTTTCCTGTGGG - Intronic
1119799960 14:77435122-77435144 GGGCCAGGAAAGCTTCCAGGTGG + Intronic
1121044714 14:90779196-90779218 GGGCCAGGAAGGCTTCCTAGAGG - Intronic
1121117397 14:91353300-91353322 AGGCCAGGAAGGCTTCCTGGAGG - Intronic
1121246006 14:92461188-92461210 GGCGCAGGAGAGAGTCCTGTTGG - Intronic
1121485419 14:94310772-94310794 AGCCCAGGTAAGTTTCCTGCAGG - Intronic
1121526351 14:94621941-94621963 GCACCAGGAGGGCTTCCTGTAGG - Intronic
1121813340 14:96910782-96910804 GGACAAGGAAGGCTTCCTGGAGG + Intronic
1121813354 14:96910853-96910875 GGACAAGGAAGGCTTCCTGGAGG + Intronic
1122045100 14:99017494-99017516 AGACCAGGAAGGCTTCCTGGAGG - Intergenic
1122343615 14:101044702-101044724 GCCCCAGGAGGGCTTCCTGGAGG + Intergenic
1122374763 14:101250452-101250474 GGCACTGGAAAGCTTCCAGACGG + Intergenic
1122407209 14:101507693-101507715 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
1122452883 14:101825441-101825463 GGACTAGGAAAGCTACCTTTTGG - Intronic
1122468219 14:101948704-101948726 AGCCCAGGAAAGCTGACCGTGGG + Intergenic
1122695848 14:103551713-103551735 AGCCCAGGGAGGCTTCCTGGCGG - Intergenic
1122799054 14:104220820-104220842 GGCCCACGACAGCTCCCTCTCGG - Intergenic
1122815383 14:104309612-104309634 GGGCCGGGAAGGCTTCCTGCTGG - Intergenic
1122824633 14:104363618-104363640 AGCCCAGGAAGGCTTCCTAGAGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123778436 15:23602903-23602925 TACCCAGGCAGGCTTCCTGTGGG - Intronic
1123782451 15:23642038-23642060 GGCCCAGCAAAACCTCCTTTGGG + Intergenic
1124493360 15:30171845-30171867 GCCCCAGGACAGCTGCCTGTGGG - Intergenic
1124750174 15:32366480-32366502 GCCCCAGGACAGCTGCCTGTGGG + Intergenic
1129450052 15:75646543-75646565 GATCAAGGAAAGCTTCCTGAAGG - Intronic
1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG + Intronic
1131385701 15:92005157-92005179 GGCCCAGAAAATCTCTCTGTAGG - Intronic
1132836997 16:1959114-1959136 AATCCAGGAAAGCTTCCTGGAGG + Intergenic
1135149314 16:19991751-19991773 GGGCTATGAAAGATTCCTGTGGG + Intergenic
1135827063 16:25738242-25738264 AGCCTAGGAAAACTTCCCGTAGG - Intronic
1135891195 16:26358975-26358997 GGCCCATGAAACCTTCCTGTTGG - Intergenic
1135991597 16:27221985-27222007 GCCCCAGGAAAGATTCTGGTTGG + Intergenic
1137601059 16:49756622-49756644 GACCCAGGGAAGCTTCAAGTTGG + Intronic
1138253256 16:55525182-55525204 AGCCAGGGAAAGCTTCCTGGAGG - Intronic
1138494450 16:57399169-57399191 GGCCCAGGAAAACATCCAGGTGG - Intergenic
1139589994 16:67928240-67928262 GGACCAGGAAGGCTCCCTGGAGG - Exonic
1143112158 17:4558851-4558873 GGCTCAGGAGGGCTTCCTGGTGG - Exonic
1144329635 17:14212306-14212328 GGCACAGGAAAGCTGGCTGCTGG - Intergenic
1144628360 17:16857038-16857060 GCTCCAGGAAAGCATCCTGGTGG - Intergenic
1144654936 17:17029378-17029400 GCTCCAGGAAAGCGTCCTGGTGG + Intergenic
1144805514 17:17964038-17964060 GGTCTAGGAAGGCTGCCTGTAGG + Intronic
1144999308 17:19292307-19292329 GGCCAGGGATAGCTACCTGTGGG + Intronic
1145375411 17:22342966-22342988 GGCTCAGGTAAGCTTTTTGTTGG + Intergenic
1145758787 17:27412960-27412982 AGCCGAGAAAAGCTGCCTGTAGG + Intergenic
1146138137 17:30341055-30341077 GGCTCAGGAAAGCTCCCAGCAGG - Intergenic
1146521050 17:33525841-33525863 GGTCTGGGAAAGCTTCCTGGAGG - Intronic
1146528665 17:33589284-33589306 GGGCCAGGAAAGCTTTCAGAAGG + Intronic
1146708836 17:35022966-35022988 GGCCGAGGATTGCTTCCTGTGGG - Intronic
1146724534 17:35146996-35147018 GTCCCAGGATAGTTTCCAGTCGG + Intergenic
1147686485 17:42289262-42289284 CGCACAGGAAAGCTATCTGTGGG + Intronic
1148192382 17:45688664-45688686 AGCCCAGGAAAGGTTCCTGGAGG - Intergenic
1148346831 17:46908792-46908814 GTCCCAGGTGAGCTTTCTGTTGG - Intergenic
1148674963 17:49439760-49439782 GTCCCAGGAAGGCTTCCTGGAGG - Intronic
1148745114 17:49913818-49913840 GGTGCTGGAAAGCTTCCTGGAGG + Intergenic
1149536589 17:57438229-57438251 GGGAGAGGAAAGCTTGCTGTGGG - Intronic
1149641550 17:58206114-58206136 GGCCCGGGAAAGCCTCCCGCAGG - Exonic
1150120043 17:62593639-62593661 GGCCCTGAAGAGCTTCCAGTGGG - Intronic
1150125229 17:62630727-62630749 ACCTCAGGAAATCTTCCTGTGGG + Intronic
1151160247 17:72159025-72159047 GGCCCAGGCATGCTTCCTCATGG + Intergenic
1151337412 17:73448006-73448028 GGGCCAGGGAAGCTTCCTTTGGG - Intronic
1151388296 17:73768888-73768910 GGTCCAGGAAGGCTTCATGGAGG + Intergenic
1151398543 17:73840997-73841019 AACCCAGGAAGGCTTCCTGGAGG + Intergenic
1152385492 17:79971835-79971857 GGCTCTGGAAGGCTTCCTCTCGG + Intronic
1152400731 17:80064902-80064924 GGCCCAGCACCGCTTCCTGTAGG - Intronic
1203162228 17_GL000205v2_random:63045-63067 GACCCAGGAACGCTTCCTGGTGG + Intergenic
1153560728 18:6369617-6369639 TGCCCAGGAAGGCTTCATGGAGG + Intronic
1153635731 18:7111411-7111433 GGCTCAGGAGAGCTTTCTTTGGG - Intronic
1155410385 18:25538029-25538051 GTCCCTGAAAACCTTCCTGTGGG - Intergenic
1155834916 18:30569045-30569067 GACCCATGAATTCTTCCTGTTGG - Intergenic
1155980659 18:32176580-32176602 GGCTCAGGAGAGCTTTCTGGGGG - Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157622832 18:49026105-49026127 GATCCAGGACAGCTTCCTGGAGG + Intergenic
1160097212 18:75885436-75885458 GGCCCTGAAGACCTTCCTGTGGG + Intergenic
1160124985 18:76163517-76163539 GGTCCAGGAAGGCTTTCTGGAGG + Intergenic
1160618419 18:80151535-80151557 GGCTCAGGCAAGCATCCTGGTGG - Intronic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1161227126 19:3151865-3151887 GGGCAGGGAAGGCTTCCTGTAGG + Intronic
1161342386 19:3750373-3750395 GGCCTAGGAAGGCTTCTTGAAGG + Intronic
1161357320 19:3826229-3826251 GGCTCAGGACAGCTTGCTGAGGG - Intronic
1161655257 19:5510460-5510482 GACCCAGGGAGGCTTCCTGGAGG + Intergenic
1161847726 19:6721233-6721255 GGTCAGGGAAAACTTCCTGTAGG + Intronic
1162016976 19:7851333-7851355 GGTCCAGGAAGGCTCCCTGGAGG + Intronic
1162879938 19:13650919-13650941 GACCCATGCAAGTTTCCTGTTGG + Intergenic
1162907172 19:13830924-13830946 GGCCCGGGAGACCTTCCTGCTGG + Exonic
1162908206 19:13835911-13835933 GGCCCAAGGCAGCTTCCTCTTGG + Intergenic
1163034239 19:14562286-14562308 GGCCCAGGGCTGCTTCCCGTGGG + Intronic
1163627403 19:18398024-18398046 GGTCCTGGAAGGCTTCCTGGAGG + Intergenic
1163776666 19:19222773-19222795 GGTCCTGGAAGGCTTCCTGGAGG - Intronic
1164220265 19:23187024-23187046 GGACCAGGACTGCATCCTGTAGG + Intergenic
1164586510 19:29479258-29479280 GACCCAGGAAAGCTGCCTGATGG - Intergenic
1165683706 19:37799698-37799720 GGCTCAGGTAAGCTTTTTGTTGG - Intronic
1165751593 19:38263919-38263941 GGCCAAGGAGGGCTTCCTGGAGG - Intronic
1166876389 19:45900426-45900448 GGTCCAGGAGGGCTTCCTGGAGG - Intronic
1167462160 19:49631207-49631229 GGCACAGGACTCCTTCCTGTTGG + Intergenic
1167533208 19:50031886-50031908 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
925354456 2:3228159-3228181 GGCCCATGAAAGCAGCCAGTCGG + Intronic
925853250 2:8104581-8104603 GGAGCAGAAAAGCTTCCTGGTGG - Intergenic
925898386 2:8490406-8490428 GACCCAGGAAGGCTTCCTGGAGG + Intergenic
926138495 2:10354341-10354363 GGCCCTGGGAAGCTTCCAGAAGG - Intronic
926209684 2:10860837-10860859 GGCCCAGGAACGCCTGGTGTTGG - Intergenic
926798485 2:16638406-16638428 GGCCGGGAAAAGCTTCCTGGAGG + Intronic
926886346 2:17602231-17602253 GGCCCAGGAATCCTTCCAATTGG - Intronic
927241947 2:20927158-20927180 GGTCATGGAAGGCTTCCTGTAGG + Intergenic
927495295 2:23547881-23547903 GGTCCAGGAAGGCTTCCAGGAGG + Intronic
927507214 2:23622326-23622348 AGTCCAGGAAAGCTGCCTGGAGG - Intronic
927700195 2:25263264-25263286 ACTCCAGGAAAGCTTCCTGGAGG - Intronic
928197068 2:29223597-29223619 GATCCAGGGAGGCTTCCTGTAGG - Intronic
931719833 2:65059185-65059207 AGCCCAAGAAATGTTCCTGTTGG + Intronic
932479673 2:72031654-72031676 AGCGCAGGAAGGCTTCCTGGGGG + Intergenic
935079427 2:99777755-99777777 TGGCCAGGCAAGCTACCTGTAGG + Intronic
935649697 2:105371749-105371771 GGCCCAAGGAAGCTTCCACTGGG - Intronic
935675733 2:105593821-105593843 GCCCCAGGCAAGCTCCCTGCTGG + Intergenic
936144956 2:109974712-109974734 TGCTCAGAGAAGCTTCCTGTGGG - Intergenic
936181642 2:110272675-110272697 TGCTCAGAGAAGCTTCCTGTGGG - Intergenic
936199730 2:110396755-110396777 TGCTCAGAGAAGCTTCCTGTGGG + Intergenic
936230924 2:110699005-110699027 TGCTCAGAGAAGCTTCCTGTGGG + Intergenic
937280109 2:120711881-120711903 GGTCCAGGAAGGCTTCCTGGAGG + Intergenic
938576925 2:132613435-132613457 GGCCAAGGAAATCATCCTGAAGG - Intronic
942266918 2:174237293-174237315 GCCCCTGAAAACCTTCCTGTGGG - Intronic
944501588 2:200365709-200365731 GGTCAAGGAAAGCTTCCAGGTGG - Intronic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
946888998 2:224254803-224254825 TTCACAGCAAAGCTTCCTGTAGG + Intergenic
947528542 2:230894114-230894136 AACCCAGGAAGGCTTCCAGTTGG + Intergenic
947552099 2:231053614-231053636 GGCCAAGAAAGGCTTCCTGGAGG + Intergenic
948264052 2:236624762-236624784 GGACTTGGAAACCTTCCTGTGGG + Intergenic
948272974 2:236688058-236688080 GGGCAAGGATGGCTTCCTGTGGG + Intergenic
948802488 2:240439224-240439246 GGCCCAGGATAGCTTCTCGGAGG + Intronic
948821774 2:240553449-240553471 GGCCCTGGAAGGCTGGCTGTAGG + Intronic
948831494 2:240600549-240600571 GGGCCAGGGCAGCTTCCTGTGGG - Intronic
948846342 2:240684464-240684486 GGGACAGGCAATCTTCCTGTGGG - Intergenic
948988179 2:241538813-241538835 GGCCCAGGTGAGCCTCCTGGAGG + Intergenic
1168818359 20:756389-756411 GGCCCTGGAATGCATCCTGCTGG + Intergenic
1169142802 20:3235691-3235713 TTACCAGGAAATCTTCCTGTAGG - Intronic
1170692339 20:18627182-18627204 GGCCAAAGAAAGCTGTCTGTTGG + Intronic
1170763634 20:19272947-19272969 GGTCCAGGAAGGCTTCCTGGAGG + Intronic
1171415241 20:24973930-24973952 GGCCTAGGGAAGCAGCCTGTGGG + Intronic
1171527513 20:25826815-25826837 GGCTCAGGTAAGCTTCTTGTTGG - Intronic
1171545951 20:26001403-26001425 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1171549313 20:26029069-26029091 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172113107 20:32559100-32559122 GGCCAGGGAAGGCTTCCTGGAGG - Intronic
1172189243 20:33051984-33052006 GGCTCATGAAGGCTTCCTGGAGG + Intergenic
1172602707 20:36194949-36194971 GGCCAGGGAGAGCTTCCTCTTGG + Intronic
1172755012 20:37277383-37277405 GGCCAAGGAGGGCTTCCTGGAGG - Intergenic
1172796612 20:37544168-37544190 GGCCCAGGAAAGCTGGCAGTGGG - Intergenic
1172847340 20:37937836-37937858 GGGCCAGGAGGGCTTCCTGGAGG + Intronic
1173724672 20:45289049-45289071 AGCCCAGGAAGGCTTCCTGGAGG - Intergenic
1174453555 20:50634394-50634416 TGTCCAGGAAGGCTTCCTGGGGG - Intronic
1175013763 20:55766094-55766116 GGTCCAGGACAGCTTTCTGCAGG - Intergenic
1175415320 20:58797081-58797103 GGCCCTGGACAGGTTACTGTGGG - Intergenic
1175680852 20:60987580-60987602 TGCCCAGGTGAGCTTCCTTTTGG + Intergenic
1175940713 20:62536363-62536385 GGGCCAGGAGGGCTTCCTGGAGG - Intergenic
1176043147 20:63076698-63076720 GGCCCTGCCAAGCCTCCTGTGGG - Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179484563 21:41701471-41701493 GTCCCAGGAGAGCTGACTGTTGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1181100791 22:20537472-20537494 GGCCTGAGCAAGCTTCCTGTAGG - Intronic
1181731413 22:24849679-24849701 GGTCCAGGAGGGCTTCCTGTAGG + Intronic
1181944495 22:26505494-26505516 GGACCAAGAAAAGTTCCTGTGGG + Intronic
1182084005 22:27548887-27548909 GGTCTAGGAAGGCTTCCTGAGGG + Intergenic
1182094229 22:27615212-27615234 GGTCCAGGAAGGCTTTCTGGAGG + Intergenic
1182099088 22:27645370-27645392 AGTCCAGGAAGGCTTCCTGGTGG - Intergenic
1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG + Intronic
1182373698 22:29830531-29830553 AGCCCAGGAGGGCTTCCTGAAGG - Intronic
1182619960 22:31613534-31613556 GGCCCAGGGCCCCTTCCTGTGGG + Intronic
1183393502 22:37559500-37559522 GGCTCAGGAAATCTTCCTAGAGG - Intergenic
1183477758 22:38045313-38045335 GGCTCAAGCAATCTTCCTGTGGG - Intergenic
1183479975 22:38058122-38058144 GGTCAAGGAAAGCTTCATGGAGG + Intronic
1183868586 22:40723584-40723606 GGGCCAGGGAGGCTTCGTGTGGG + Intergenic
1184111221 22:42396752-42396774 GGCCAAGGAAATGTCCCTGTGGG - Intronic
1184112317 22:42402527-42402549 GACCCAGCAAAGCTGCCTATGGG + Intronic
1184242371 22:43217920-43217942 GGTTCAGGGAAGCTTCCTGGAGG - Intronic
1184569057 22:45310498-45310520 GGCCCGGGGCATCTTCCTGTGGG + Intronic
1184616163 22:45640047-45640069 AACCCAGGACAGCTTCCTGGAGG + Intergenic
1184694094 22:46130279-46130301 GGCCCATGCATGCTCCCTGTAGG - Intergenic
1184890891 22:47378450-47378472 AGCCCAGGAAGGCTTCCTGGAGG + Intergenic
1185316287 22:50180620-50180642 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
1185343735 22:50302529-50302551 GGCCCAGCAAAGCTCGCTGGAGG - Intronic
949406155 3:3716757-3716779 GGGCAAGGAAGGCTTCCTGGAGG - Intronic
949564549 3:5232763-5232785 AGACCAGGAGAGCTTCCTGCTGG + Intergenic
950644594 3:14369533-14369555 GGTCTAGGAAGGCTTCCTGGAGG - Intergenic
950646165 3:14378111-14378133 GCCCCAGGCAAGCCTCCTGATGG + Intergenic
950793837 3:15494649-15494671 AGTCAAGGAAAGCTTCCTGGTGG - Intronic
951096926 3:18643366-18643388 GGCTCATGTAAGCTTCTTGTGGG + Intergenic
953692934 3:45134822-45134844 GGCCCAGGGCAGCTTCCAGGAGG + Intronic
954658896 3:52215860-52215882 GACCCAGGAAAGTTTTCTGCAGG - Intergenic
956001800 3:64737773-64737795 GGTCCAGGAAGGCTTTCTGGAGG + Intergenic
956425349 3:69128690-69128712 GGTCCAGGAGGGCTTCCTGGAGG - Intergenic
956451439 3:69378924-69378946 GGACCAAGGAAGCTTCCTGGAGG - Intronic
959468017 3:106714104-106714126 GGCCCAAAACAGCTTCCTGCTGG - Intergenic
960939593 3:122924809-122924831 GATCAGGGAAAGCTTCCTGTAGG - Intronic
962752099 3:138441066-138441088 GGCCCAGGAAGCCTTCTTGGAGG + Intronic
962978798 3:140469526-140469548 GACCCAGGATGGCTTCCTGGGGG - Intronic
963601855 3:147385461-147385483 GGCCCAGGGAAGTGTCATGTGGG + Intergenic
967063334 3:185891896-185891918 GACCCAAGCAAGCTTCCTTTAGG - Intergenic
968026368 3:195445880-195445902 CGGCCAAGAAAGCTTCCTGAGGG - Intergenic
968208664 3:196827384-196827406 GCCCTAGGAAAGCTTTCTGTCGG - Intronic
968261492 3:197328478-197328500 TGTCCAGGAAAGCTTCCTCAGGG + Intergenic
968280931 3:197476212-197476234 AACCCAGGAAGGCTTCCTGGAGG - Intergenic
968572582 4:1349805-1349827 GCCCAAGGCAAGCTTCTTGTAGG - Exonic
969060088 4:4427267-4427289 GTGCCAGGAAAGCTCCCTGCAGG + Intronic
969235843 4:5864687-5864709 GGTCAAGGAAGGCTTCCTGGAGG + Intronic
969578503 4:8050390-8050412 GCCCCAGGAAAGGTTGCAGTAGG - Intronic
969723696 4:8907126-8907148 GGTGCAGGAAGGCTTCCTGGAGG - Intergenic
969862426 4:10048151-10048173 TGCCCAGTAAGGCTTCCTGTTGG - Intronic
970221941 4:13820766-13820788 GGTCAAGGAAGGCTTCCTGGAGG + Intergenic
971154118 4:24064081-24064103 GGCCCTGGAAAGCCTCTTCTGGG - Intergenic
971344293 4:25797931-25797953 GACCCAGGAAGGCTTCCAGAGGG + Intronic
972311486 4:37887805-37887827 GGCCCAGGAAGGTGTTCTGTTGG - Intergenic
973957435 4:56076696-56076718 GGGCCAGAAAAGCCTCCTGGAGG - Intergenic
974565586 4:63575741-63575763 GGCCCAGCTCAGCATCCTGTAGG - Intergenic
976700888 4:87967284-87967306 GAGCCAGGACAGCTGCCTGTGGG + Intergenic
977283443 4:95070589-95070611 GGCTCAGGAAAGGATACTGTAGG + Intronic
977913301 4:102562257-102562279 GGTCAGGGAAAGCTTCCTGAGGG - Intronic
982282974 4:153704796-153704818 AGCCCAGGAAAGCTCCCAGCAGG + Exonic
982855139 4:160372463-160372485 GGCCAAGGAAATATTACTGTAGG - Intergenic
983345799 4:166524304-166524326 GGACCAGGATCGCGTCCTGTAGG + Intergenic
983799880 4:171914214-171914236 TGCCCAGGAAAGTTCCCTTTGGG + Intronic
984549448 4:181143105-181143127 GGACCAGGAAGGCTTTCTGAAGG + Intergenic
984943581 4:184954341-184954363 GACCCAGGAAAGCTCCCAGGAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
988640597 5:33037111-33037133 GGCCCAGGAAAGATGACTGAAGG + Intergenic
989988176 5:50727781-50727803 GTACCAGGAAAGTTTCCTGCAGG - Intronic
990280182 5:54242089-54242111 GGCCCAGCAATGCCTCCTGAGGG + Intronic
990813928 5:59761662-59761684 GCCCCAGAAGAGCTTCCAGTGGG - Intronic
995911824 5:117196682-117196704 GAACCAGGAGAGATTCCTGTAGG - Intergenic
996745194 5:126841485-126841507 GGACCAGGATTGCGTCCTGTAGG - Intergenic
998878649 5:146625625-146625647 GGTCCAGGAAGTCTTCCTGGAGG + Intronic
999238843 5:150115762-150115784 AGCAGAGGATAGCTTCCTGTAGG - Exonic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1001421388 5:171589898-171589920 GGCCCAGGAAGCCCTGCTGTAGG + Intergenic
1001515519 5:172352937-172352959 GGGTCAGGAAGGCTTCCTGAGGG - Intronic
1001557011 5:172643449-172643471 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
1004610345 6:17233677-17233699 GGCCCAGGCTAGCTGCCTGCTGG + Intergenic
1006375982 6:33671862-33671884 AACCCAGGAAGGCTTCCTGGAGG - Intronic
1006795275 6:36728466-36728488 AACCCAGGAAGGCTTCCTGGGGG + Intronic
1007078434 6:39082558-39082580 GGACCAGGACTGCCTCCTGTGGG - Intronic
1007102571 6:39259882-39259904 AGTCCAGGAAGGCTTCCTGGAGG - Intergenic
1007249908 6:40488469-40488491 GGTCCAGGAAGGCTTCCTGCAGG - Intronic
1007472252 6:42098634-42098656 GGCTGGGGAAGGCTTCCTGTAGG + Intergenic
1007844665 6:44743229-44743251 GTCCCAGGAAAGCTTTCTTGTGG - Intergenic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1008619915 6:53261701-53261723 TGCTCAGGAAAGCTGCCTGCAGG - Intergenic
1010249229 6:73691287-73691309 GCCCCAGGAAAGCCTCCAGCTGG + Intergenic
1011280779 6:85675279-85675301 GGCAGAGGAAAAATTCCTGTTGG + Intergenic
1012690717 6:102307905-102307927 GGCCCATGAAAGCATCCAGGGGG - Intergenic
1013306427 6:108850932-108850954 TGTCCAGGAAAGCTTCCTTGAGG + Intronic
1013402331 6:109810825-109810847 GTCCCAGGAAAGATGCTTGTGGG + Intronic
1014432626 6:121388681-121388703 GGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1015004533 6:128263089-128263111 GGCCCAGGGAGCGTTCCTGTGGG - Intronic
1015851400 6:137576581-137576603 GGCCCTGGAAGGCTTACTGCAGG + Intergenic
1016409909 6:143771944-143771966 GGTCCATGAAAGCTTCCTGAAGG + Intronic
1017816868 6:158022407-158022429 AGGCCAGGAAAGCTGGCTGTTGG - Intronic
1018331779 6:162736520-162736542 AGTCCAGGAAAGTTTCCTGAAGG + Intronic
1019548817 7:1592214-1592236 GGGCCAGCCATGCTTCCTGTCGG - Intergenic
1020277205 7:6631944-6631966 AGCCCAGGAGGGCTTCCTGCAGG + Intergenic
1020875628 7:13690008-13690030 GGTCAAGGAAAGCTTTCTGTTGG - Intergenic
1020882837 7:13783748-13783770 GGTCCTGGAGAGCTTTCTGTAGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1022528022 7:31050915-31050937 AGTCCAGGAGAGCTTCCTGGTGG - Intergenic
1023143900 7:37130073-37130095 AGGTCAGGAAAGCTTCCTGGAGG - Intronic
1024093666 7:45967878-45967900 GACCCAGGCAAGCTTCTTTTTGG + Intergenic
1024290496 7:47800388-47800410 GGGCCAGGGAAGCTTCCTGGAGG + Intronic
1024937399 7:54724817-54724839 GGCCCAGGCAAGATTTCTCTAGG - Intergenic
1024948332 7:54833921-54833943 GGCGCAGGGAAGCTTCCGGAGGG + Intergenic
1026042485 7:66879552-66879574 GGAACAGGAAATCTTCCTGGTGG + Intergenic
1026681049 7:72466970-72466992 GGCATAGGAAGGCTTCCTGGAGG + Intergenic
1026859759 7:73778178-73778200 GGTCCAGGAGGGCTTCCTGTAGG + Intergenic
1027538106 7:79432634-79432656 TGCCCAGGAGGGCTGCCTGTTGG + Intronic
1028231504 7:88311178-88311200 GTTCCAGGAAAGATTCCTATTGG - Intergenic
1029593372 7:101522215-101522237 GGTCAAGGAAGGCTTCCTGGAGG - Intronic
1029623183 7:101702706-101702728 TGTCCAGGAAGGCTTCCTGGAGG + Intergenic
1029623830 7:101707275-101707297 GGCCCAGGAAGGCTTCCTGAAGG - Intergenic
1029991262 7:104964766-104964788 AGCCCTGAAAAGCTTACTGTAGG + Intergenic
1032066544 7:128775664-128775686 TGCCCATGAAAGCTGCCTGGAGG + Exonic
1032081374 7:128860115-128860137 GGTCCAGGAAAACTTCCTGTTGG - Intergenic
1033419671 7:141194574-141194596 AGCCCAGGAAAGCTGCTGGTGGG - Intronic
1033608247 7:142942985-142943007 GGCACAGGTGAGCTTCCTGGAGG + Exonic
1034478084 7:151300276-151300298 GGGCCTGAAAAGCTTCCTCTTGG + Intergenic
1035264378 7:157683036-157683058 GGGCCAGCACAGCGTCCTGTGGG - Intronic
1035404466 7:158588397-158588419 GTCCCAGGAAAGCTCCCGGAGGG + Intergenic
1035476522 7:159148095-159148117 GGCCCAGCAAAGCTGTCTGTTGG + Intergenic
1036204474 8:6794885-6794907 GGACAAGGAAGGCTTCCTGGTGG - Intergenic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1037211156 8:16389387-16389409 GGTCCAGGAAGGCTTACTGGAGG + Intronic
1038330478 8:26604422-26604444 GGGCCTGGAAGGCTTCCTGGAGG + Intronic
1039919686 8:41884505-41884527 GACTCAGGAAAGCTTCCTGGAGG + Intronic
1041201379 8:55453963-55453985 GGCCCAGGAAGGCTGCCTTATGG + Intronic
1041456067 8:58061628-58061650 GACCCAAGAAAGTTTCCTGAAGG + Intronic
1045402499 8:101833110-101833132 GGCCCAGGCAAGTTTCCAGAAGG - Intronic
1045569387 8:103353532-103353554 GGCCATGGAAGGCTTCCTGTAGG - Intergenic
1048385902 8:133912346-133912368 AGTCCAGGAAGGCTTCCTGGGGG + Intergenic
1048973670 8:139658971-139658993 AGCCCAGGAAAGCTCCCAGAAGG + Intronic
1049220494 8:141426688-141426710 GGTCCAGGAAGGCTTCCTGGAGG + Intronic
1049426495 8:142540244-142540266 GCCCCAGGAGGGCTTCCTGGAGG + Intronic
1049708734 8:144054348-144054370 GGCCCAGGAAGGCCTCCCGAGGG - Intronic
1049916466 9:322790-322812 GGCCCAGGAAAGCCTCCAATTGG + Intronic
1050274169 9:3979573-3979595 GGTCCAAGAAGGCTTCCTGAAGG - Intronic
1051497327 9:17737956-17737978 GGCTGGGAAAAGCTTCCTGTAGG - Intronic
1053410181 9:37911230-37911252 GTGCCAGAAAGGCTTCCTGTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1053795472 9:41722983-41723005 GGCTCAGGTAAGCTTTTTGTTGG - Intergenic
1053798857 9:41750763-41750785 GACTCAGGTAAGCTTCTTGTTGG - Intergenic
1054146350 9:61564189-61564211 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1054149709 9:61591893-61591915 GGCTCAGGTAAGCTTTTTGTTGG + Intergenic
1054183882 9:61935038-61935060 GGCTCAGGTAAGCTTTTTGTTGG - Intergenic
1054187272 9:61962822-61962844 GACTCAGGTAAGCTTCTTGTTGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054466081 9:65495282-65495304 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1054469475 9:65523003-65523025 GGCTCAGGTAAGCTTTTTGTTGG + Intergenic
1054651239 9:67625712-67625734 GGCTCAGGTAAGCTTCTTGTTGG + Intergenic
1054654623 9:67653448-67653470 GGCTCAGGTAAGCTTTTTGTTGG + Intergenic
1056376021 9:86011699-86011721 GACCCAAAAAAGCTGCCTGTTGG - Intronic
1056591413 9:87968636-87968658 GGTCAAGCAAAGCTTCCTGGTGG - Intronic
1057079402 9:92161085-92161107 GGCCCAGGAAAGCTGCAAGGAGG - Intergenic
1057336550 9:94160166-94160188 GACCCAGGAAAGCTAGCTGGTGG + Intergenic
1057833508 9:98425888-98425910 GGTCCGGGAAGGCTTCATGTAGG + Intronic
1058711589 9:107683795-107683817 GGCCAGGGAAAGCTTCCTAGAGG - Intergenic
1059343907 9:113615576-113615598 GGAGCAGGAAGGCTTCCTGGAGG + Intergenic
1060432065 9:123559022-123559044 GGTCAAGGAAGGCTTCCTGGAGG + Intronic
1060495194 9:124113317-124113339 GGTCAAGGAAGGCTTCCTGAGGG - Intergenic
1060561495 9:124548731-124548753 GGTCAAGGAAAGCTTCTTGGAGG - Intronic
1060665218 9:125428592-125428614 AGCCCAGGCAGGCTTCCTGGAGG + Intergenic
1060955271 9:127634276-127634298 GCCCCAGGGAAGCTTCCAGAAGG - Intronic
1060996236 9:127876177-127876199 AGTCCAGGAAGGCTTCCTGAAGG - Intronic
1061077261 9:128349169-128349191 GGCTCAGGAAGGCTGCCTGGAGG - Intronic
1061398401 9:130355592-130355614 GGCCCTGGAAGGCCTCCTGGAGG + Intronic
1062429057 9:136518911-136518933 AGCCCAGGAAGGCTTCCTGGAGG - Intronic
1062586115 9:137250836-137250858 GGCCCAGGAAGGCTCCCTGGAGG - Intergenic
1203759520 EBV:4882-4904 GGGCCATGAAAGCCTCCTGGCGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185709947 X:2296028-2296050 GGTTCAGGAAAACTTCCTGAAGG - Intronic
1185746885 X:2580836-2580858 GTTCCAGGAAAGCATCCTGAGGG + Intergenic
1185870262 X:3658822-3658844 GGCCCAGGAAACCTTCCCTGAGG + Intronic
1189731404 X:44024812-44024834 GGCCCAGGAAGGCTTCCCAGAGG + Intergenic
1189850450 X:45171701-45171723 GGGCCAGGAAAGCTGCCTGGAGG - Intronic
1192158060 X:68761378-68761400 GACCAAGGAAAGTTTCCTGGAGG - Intergenic
1192212949 X:69139308-69139330 GGCTCAGAAATGCTTCCTTTAGG - Intergenic
1192233229 X:69279924-69279946 GGACCAAGAAGGCTTCCTGCGGG - Intergenic
1192245919 X:69371459-69371481 GGCCAAGGGAAGCTTCCTGGTGG + Intergenic
1192882759 X:75304640-75304662 GGCCCACAACAGCTTCCTATGGG - Intergenic
1194779880 X:98011180-98011202 GGCCCAGGAAAGCAGCCAGGAGG + Intergenic
1196497731 X:116341765-116341787 GGCCATGGAAAGCTTCCTGAAGG + Intergenic
1196784017 X:119406649-119406671 GGGCAAGGAACCCTTCCTGTTGG - Exonic
1196981278 X:121216424-121216446 GGTCAAGGAAAGCTTCCTAGAGG - Intergenic
1200229868 X:154438516-154438538 CCCCCAGGAATGCATCCTGTCGG + Exonic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic
1201355437 Y:13092507-13092529 TGCCCAGGACATCTCCCTGTGGG + Intergenic
1201400636 Y:13600488-13600510 GGGCCAGGAACTCTTTCTGTGGG - Intergenic
1202071332 Y:20994643-20994665 GGCACAGCAAACCTTCCTCTTGG - Intergenic