ID: 1157117406

View in Genome Browser
Species Human (GRCh38)
Location 18:44875002-44875024
Sequence TGTATTGGTTTGCTACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157117406 Original CRISPR TGTATTGGTTTGCTACAGAT GGG Intronic
901269088 1:7936648-7936670 TGTATTGGTTTGTAACAGACTGG - Intronic
903411408 1:23146624-23146646 TGTATTGTTTTGATAGAGATGGG - Intronic
903587809 1:24429661-24429683 TGGCTTGATTGGCTACAGATAGG + Intronic
903795944 1:25929017-25929039 TGCATTGGTTTGCTGCTGACTGG - Intergenic
904067100 1:27761788-27761810 TGTATTTTTTTAGTACAGATGGG - Intronic
909259190 1:73465116-73465138 TGCATTGGTTTGGTTCAGAAAGG + Intergenic
914849371 1:151302754-151302776 TGTATTTTTTTGGTAGAGATGGG + Intronic
915139582 1:153758933-153758955 TGTTTTGTTTTGGTAGAGATGGG - Intronic
917134179 1:171772777-171772799 TGTATTGTTTTGGTAGAGACTGG - Intergenic
917285653 1:173419164-173419186 TGTATTTTTTTGGTAGAGATGGG - Intergenic
917423334 1:174887861-174887883 TGTATTTTTTTGGTAGAGATTGG - Intronic
917999349 1:180476952-180476974 TGTTTTGGTTAGCTTCAGAGGGG - Intronic
920490888 1:206414206-206414228 TGTATTTTTTTGTTAGAGATGGG + Intronic
921081772 1:211745283-211745305 TGTATTTATTTTATACAGATGGG - Exonic
921846152 1:219884479-219884501 AGTATTGGTTTGCATCAGATTGG + Intronic
922813623 1:228433275-228433297 TATATTGGTTTGGTTCAGAAAGG - Intergenic
923392813 1:233530782-233530804 TGTATTGACTTGCCACATATTGG + Intergenic
923575842 1:235158241-235158263 TGTATTTTTTTGGTAGAGATGGG - Intronic
923701554 1:236304447-236304469 TTTATTGGGTTGATACAGAAAGG - Intergenic
923892147 1:238227696-238227718 TGTATTTTTTTGGTAGAGATGGG + Intergenic
924126671 1:240861615-240861637 TTTATTGGTTTACCACACATTGG - Intronic
924349466 1:243101144-243101166 TGTATTTTTTTTCTAGAGATGGG - Intergenic
924454006 1:244203529-244203551 TGTCTAGGTTTACTAAAGATCGG + Intergenic
924608718 1:245556571-245556593 TGTATTTTTTTGGTAGAGATGGG + Intronic
1063100010 10:2942085-2942107 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1063130983 10:3176311-3176333 TGTATTTGTTTGCTAAAGCCAGG - Intergenic
1064206068 10:13324783-13324805 TGTATTTTTTTGGTAGAGATGGG + Intronic
1064451969 10:15450361-15450383 TGTATTTTTTTGGTAGAGATTGG - Intergenic
1064783038 10:18863807-18863829 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1065051858 10:21801220-21801242 AATGTTGGTTTGCTACAGAATGG + Intronic
1065549616 10:26857467-26857489 TGTATTTGTTTTGTAGAGATGGG - Intronic
1067021659 10:42805269-42805291 TGTATTGGTTGGCCATATATGGG + Intronic
1067167227 10:43874945-43874967 TGTATTGCTTTTCTATAGAATGG - Intergenic
1067416032 10:46103913-46103935 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1067982697 10:51104900-51104922 TGTATTGTTTTAGTAGAGATGGG + Intronic
1068040255 10:51815357-51815379 TGAATTTGTTTGTTACAGAATGG - Intronic
1068438465 10:57020286-57020308 TACATTGGTTTGCTCCAGAAAGG + Intergenic
1070100179 10:73378201-73378223 TGTATTTTTTTGGTAGAGATGGG - Intronic
1070272181 10:74966852-74966874 TGTATTTTTTTGGTAGAGATGGG - Intronic
1072263487 10:93704872-93704894 TGTATTTTTTTACTAGAGATGGG + Intergenic
1072657580 10:97340972-97340994 TGTTTTGTTTTGGTAGAGATGGG - Intergenic
1073055727 10:100699900-100699922 TGTATTAGTTATCTACAGATAGG - Intergenic
1073819856 10:107249340-107249362 TGCATTGGTTTGGTCCAGAAAGG - Intergenic
1073905725 10:108277059-108277081 TGCATTGGTTTGGTCCAGAAAGG + Intergenic
1074074395 10:110109317-110109339 TGTATGCATTTGCTAGAGATGGG - Intronic
1074119105 10:110480089-110480111 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1074604504 10:114947330-114947352 TGTATTGTTTTAAGACAGATTGG + Intronic
1075658620 10:124177807-124177829 TGTGTTTGTTTGCTGCAGAGGGG - Intergenic
1076976752 11:178166-178188 TGTCTGACTTTGCTACAGATTGG + Intronic
1077291106 11:1794082-1794104 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1079064999 11:17282430-17282452 TGTATTTGTTTAGTAGAGATGGG + Intronic
1081152031 11:39644730-39644752 TGTTTTGCATTGCTACAGGTTGG + Intergenic
1081171946 11:39880627-39880649 TGTATTTTTTTAGTACAGATGGG + Intergenic
1082037631 11:47658180-47658202 TGTATTTTTTTGCTAGAGACAGG + Intergenic
1082962431 11:58931936-58931958 TGTACTGTTTTACTAGAGATGGG - Intronic
1083105899 11:60358513-60358535 TATATTGGTTTGGTCCAGAAAGG + Intronic
1083253741 11:61484063-61484085 TGTATTTTTTTGGTAGAGATGGG - Intronic
1087146005 11:94812302-94812324 TATATTGGTTTGGTCCAGAAGGG + Intronic
1087384515 11:97453475-97453497 TGTATTTTTTTAGTACAGATAGG + Intergenic
1087846838 11:102983138-102983160 TTTTTTGTTTTGCTAGAGATGGG - Intergenic
1088093123 11:106066025-106066047 TGTTTTGCTTTGGTATAGATGGG + Intronic
1088227305 11:107635284-107635306 TGTTTTGTTTTGGTAGAGATAGG + Intronic
1088611309 11:111579958-111579980 TGTAATGGTGTGATACAGAGCGG + Intergenic
1089276724 11:117341615-117341637 TGTATTGTGTTGGTAGAGATGGG + Intronic
1090054620 11:123411819-123411841 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1090058469 11:123443481-123443503 TATATTGGTTTGGTCCAGAAAGG + Intergenic
1092483989 12:8885633-8885655 TGTATTGTTTTGATAGAGTTGGG + Intronic
1092492927 12:8962540-8962562 TGTATTTTTTTGGTAGAGATGGG - Intronic
1092613741 12:10197651-10197673 TATATTGGTTTGGTCCAGAAAGG - Intergenic
1092773114 12:11916621-11916643 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1094239356 12:28203532-28203554 TTAAATGGTTTGCTACATATGGG - Intronic
1094702950 12:32888006-32888028 TGTATTTTTTTTGTACAGATGGG - Intronic
1097235217 12:57534839-57534861 TGTATTTTTTTAGTACAGATGGG + Intronic
1097638519 12:62150729-62150751 TGTATTTTTTTGGTAGAGATGGG - Intronic
1097707678 12:62884695-62884717 TGTATTGGTTTTCTACTACTAGG + Intronic
1097971317 12:65636157-65636179 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1098553749 12:71794609-71794631 TGTATTTTTTTGGTAGAGATGGG + Exonic
1098720601 12:73892628-73892650 TGTATTTATTTGGTAAAGATGGG + Intergenic
1099184268 12:79500430-79500452 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1100044300 12:90359612-90359634 TGTATTAGTTTCCTATGGATAGG - Intergenic
1100257265 12:92897001-92897023 TGTATTTTTTTGGTAGAGATGGG - Intronic
1101122911 12:101602386-101602408 TGTATTTTTTTGGTAGAGATAGG + Intronic
1103213967 12:119187527-119187549 TGTATTTGTTTAGTAGAGATGGG + Intronic
1103651815 12:122438788-122438810 TGTTTTTGTTTGGTAGAGATAGG + Intergenic
1105479262 13:20758387-20758409 TATATTGGTTTGGTCCAGAAAGG - Intronic
1105869831 13:24495046-24495068 TGTATTTTTTTGGTAGAGATGGG + Intronic
1106874806 13:34060033-34060055 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1107156960 13:37178977-37178999 TATTTTTGTTTTCTACAGATAGG + Intergenic
1107557805 13:41533058-41533080 TGTATTGGCTTTCTTCAGTTTGG - Intergenic
1107646270 13:42497057-42497079 TGTATTGTTTTAGTAGAGATGGG - Intergenic
1107780355 13:43895010-43895032 TGTATTTATTTTATACAGATGGG - Intergenic
1108332917 13:49408651-49408673 TGTATTTTTTTGGTAGAGATGGG - Intronic
1108964106 13:56274766-56274788 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1108985718 13:56584742-56584764 TCATTTTGTTTGCTACAGATTGG + Intergenic
1109362753 13:61317304-61317326 GGTTTTGGTTTTCTACAGAGAGG + Intergenic
1110106304 13:71680428-71680450 TGTATTTTTTTTCTAGAGATGGG - Intronic
1111472709 13:88705988-88706010 TACATTGGTTTGCTTCAGAAAGG + Intergenic
1112471896 13:99696771-99696793 TGTTTTGTTTTGGTAGAGATGGG - Intronic
1112471973 13:99697539-99697561 TGTATTTTTTTGGTAGAGATGGG + Intronic
1113161952 13:107391780-107391802 TATATTGGTTTGATTCAGAAAGG - Intronic
1114273661 14:21121722-21121744 TGTATTTTTTTGGTAAAGATGGG + Intergenic
1115493080 14:33977640-33977662 TGGATTGATGTGCTACAGAATGG + Intronic
1115594712 14:34898140-34898162 TGTTTTGTTTTGGTAGAGATGGG + Intergenic
1115734175 14:36306175-36306197 TGTTTTGATCTGTTACAGATAGG - Intronic
1116609758 14:47053272-47053294 TGTATTAATTTGAAACAGATGGG - Intronic
1117015031 14:51509348-51509370 TGTATTTTTTTAGTACAGATGGG - Intronic
1117573273 14:57071183-57071205 TTTATTTGTTTGCTTTAGATAGG - Intergenic
1119094462 14:71816259-71816281 TGGATTGGGTTGTTACAGAATGG - Intergenic
1119454325 14:74741641-74741663 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1120298118 14:82671010-82671032 TGTAGTGTATTGTTACAGATGGG + Intergenic
1120926099 14:89798958-89798980 TGTATTTTTTTGGTAAAGATGGG + Intronic
1120929137 14:89830502-89830524 AGTATCGGTTTGCAACAGACTGG + Intronic
1122563769 14:102636450-102636472 TGTATTTGTTTACTAGAGATAGG + Intronic
1122644846 14:103187529-103187551 TGTTTTGTTTTGGTAGAGATAGG - Intergenic
1123480048 15:20622705-20622727 TGAATTTGTTTGCCACAGTTGGG - Intergenic
1123637959 15:22377659-22377681 TGAATTTGTTTGCCACAGTTGGG + Intergenic
1123756255 15:23399720-23399742 TGTATTTTTTTGATACAGACAGG - Intergenic
1123888921 15:24756137-24756159 TATATTGGTTTGGTCCAGAAAGG + Intergenic
1124401239 15:29349553-29349575 TGTTTTGGTTTCCTACAGTATGG + Intronic
1124576606 15:30914536-30914558 TGTATTTTTTTGGTAGAGATGGG + Intronic
1125157434 15:36603888-36603910 TGCCTTGGTTTGCTGCAAATTGG + Intronic
1125472671 15:40019985-40020007 TGTATTTTTTTGGTAGAGATGGG - Intronic
1125691574 15:41600304-41600326 TGTATTTGTTTGTTTGAGATAGG - Intergenic
1125913728 15:43465824-43465846 TGTTTTGTTTTGGTACAGACAGG + Intronic
1125962548 15:43844444-43844466 TGTATTTTTTTACTACAGACGGG - Intronic
1125978662 15:43979164-43979186 TGTATTTTTTTGGTAGAGATGGG - Intronic
1127280106 15:57482207-57482229 TGTTTTGTTTTACTAGAGATTGG - Intronic
1129358418 15:75008671-75008693 TGTATTTTTTTGGTAGAGATGGG + Intronic
1129913789 15:79249859-79249881 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1131049439 15:89336783-89336805 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1131267110 15:90922773-90922795 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1131529214 15:93178021-93178043 TGTATTTTTTTGGTACAGACGGG + Intergenic
1131585278 15:93686091-93686113 TCTGTGGGTTTGCGACAGATGGG - Intergenic
1132136946 15:99350969-99350991 TGTATTTTTTTGGTAGAGATAGG + Intronic
1132818250 16:1846207-1846229 TGAATTGCTGTGCTTCAGATGGG + Intronic
1133263819 16:4570995-4571017 TGTTTTTGTTTGGTAGAGATGGG - Intronic
1134330174 16:13243405-13243427 TATATTGGTTTGGTCCAGAAAGG + Intergenic
1135197743 16:20408576-20408598 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1135225079 16:20648782-20648804 TATATTGGTTTGGTCCAGAAAGG - Intronic
1135569902 16:23541151-23541173 TGTATTTTTTTGGTAGAGATGGG - Intronic
1136576609 16:31128946-31128968 TGTACTGGTTTCCCGCAGATGGG + Intronic
1138159516 16:54740319-54740341 TGCATTGCTTTGGTAGAGATGGG - Intergenic
1138633373 16:58317121-58317143 TATATTGGTTTGGTCCAGAAAGG - Intronic
1139140999 16:64262380-64262402 TTTATTGGTTTGGTACTTATTGG + Intergenic
1139586035 16:67904375-67904397 TGTATTTTTTTGGTAGAGATGGG + Intronic
1139740563 16:69031832-69031854 TGTATTGTTTTAGTAGAGATGGG + Intronic
1140227709 16:73091873-73091895 TGTATTGGTTTGCTAAGGTGAGG - Intergenic
1141939152 16:87263198-87263220 TGTATTTTTTTTCTAGAGATGGG + Intronic
1142463764 17:115207-115229 TGTCTGACTTTGCTACAGATTGG + Intergenic
1143034740 17:3987998-3988020 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1143420507 17:6787946-6787968 TATATTGGTTTGATTCAGAAAGG + Intronic
1143769184 17:9157169-9157191 TGTGTTGGTTTGCTGAGGATAGG - Intronic
1143819654 17:9550048-9550070 TGTATTTTTTTAGTACAGATGGG - Intronic
1143855647 17:9846442-9846464 TGTATTGATTTTTTAGAGATGGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1145718602 17:27047249-27047271 TGTATTTTTTTGCTAAAGATGGG - Intergenic
1147811915 17:43177097-43177119 TGTATTTTTTTGGTAGAGATGGG - Intronic
1148251574 17:46085661-46085683 TGTATTTTTTTGGTAGAGATGGG + Intronic
1150304333 17:64071591-64071613 TGTATTTTTTTAGTACAGATGGG + Intronic
1150742246 17:67788695-67788717 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1151752454 17:76047610-76047632 TGTATTTGTTTTGTAGAGATGGG - Intronic
1153604832 18:6822103-6822125 AATATTGGTATGGTACAGATGGG + Intronic
1153937749 18:9945531-9945553 TGTATTTTTTTGGTAGAGATGGG + Intronic
1155146192 18:23085702-23085724 TATATTGGTTTGGTTCAGAAAGG + Intergenic
1156037761 18:32784746-32784768 TGTTTTGTTTTGGTAGAGATAGG + Intergenic
1156684227 18:39625297-39625319 TGTATTTGTTTGCTATTTATTGG + Intergenic
1157117406 18:44875002-44875024 TGTATTGGTTTGCTACAGATGGG + Intronic
1157313701 18:46571294-46571316 TATATTTTTTTTCTACAGATGGG - Intronic
1157353168 18:46909417-46909439 TGTTTTGTTTTGGTAGAGATGGG + Intronic
1157909748 18:51604598-51604620 TGCATTGGTTTGGTTCAGAAAGG + Intergenic
1158167336 18:54555257-54555279 TATATTGGTTTGGTCCAGAAGGG + Intergenic
1158237957 18:55340353-55340375 TGTCTTGGTTTGATAGAGATGGG + Intronic
1159039546 18:63310541-63310563 TGTCTTGGTCTCCTACTGATTGG + Intronic
1159659884 18:71081682-71081704 TGTAATATTTTCCTACAGATAGG + Intergenic
1160421773 18:78752943-78752965 TGTATTGGTTTCTGACAGCTTGG + Intergenic
1160743497 19:698923-698945 TTTATTTGTTTGGTAGAGATGGG + Intergenic
1161795773 19:6385898-6385920 TCTATTTTTTTGGTACAGATGGG - Intronic
1163044548 19:14630133-14630155 TGTCTGGGCTTGCTACAGGTGGG - Exonic
1163355769 19:16809728-16809750 TGTATTTTTTTGGTAGAGATGGG + Intronic
1163670548 19:18625553-18625575 TGTATTGTTTTATTAGAGATGGG + Intergenic
1163910179 19:20182585-20182607 TGTTTGGGTTTGGTACAGACAGG + Intronic
1163922068 19:20299296-20299318 TGTATTTTTTTGGTAGAGATGGG + Intergenic
1164079227 19:21848315-21848337 TGTATTGTTTTAGTAGAGATGGG + Intronic
1164242174 19:23399270-23399292 TATATTGGTTTGGTTCAGAAAGG + Intergenic
1164297877 19:23931143-23931165 TGTATTGTTTTAGTAGAGATGGG + Intronic
1164923844 19:32110387-32110409 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1165451399 19:35885822-35885844 TGTATTTGTTTAGTAGAGATTGG - Intergenic
1166335929 19:42107174-42107196 TGTATTTTTTTGGTAGAGATGGG - Intronic
1166418303 19:42612305-42612327 TATATTGGTTTGGTTCAGAAAGG - Intronic
1166515092 19:43440506-43440528 TGTTTTGGTTTTTTACAGACAGG - Intergenic
1167273824 19:48522712-48522734 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1202698045 1_KI270712v1_random:139765-139787 TGTGTTGTTTTGTTTCAGATGGG + Intergenic
925231820 2:2239723-2239745 TTTATTGGTTTGCTATAGTTTGG - Intronic
925791683 2:7495144-7495166 TGTATTTTTTTGGTAGAGATGGG + Intergenic
926458828 2:13102288-13102310 TGTATTTATTTTTTACAGATAGG + Intergenic
926841354 2:17084033-17084055 TAAATTGGTTTCCTACAGAAAGG + Intergenic
927975215 2:27333324-27333346 TGTATTTTTTTGGTAGAGATAGG + Intronic
929077899 2:38093553-38093575 TGTACTGGTGTGGTATAGATGGG - Intronic
929907117 2:46055832-46055854 TGTATAGTTTTGTTAGAGATGGG + Intronic
930118495 2:47740418-47740440 TGCATTGGTTTGATTCAGAAAGG - Intronic
930154777 2:48094757-48094779 TGTATTCTTGTGCTACAGGTGGG - Intergenic
930216903 2:48707048-48707070 GGTGTTGGTGAGCTACAGATGGG + Intronic
930677336 2:54217542-54217564 TGTATTTTTTTGGTATAGATGGG + Intronic
931339394 2:61384497-61384519 TGTATTTTTTTGGTAGAGATGGG - Intronic
931635069 2:64333397-64333419 TACATTGGTTTGCTCCAGAAAGG + Intergenic
931926690 2:67081122-67081144 TGTATTGGTTTGTTTTAGTTTGG - Intergenic
933496993 2:83062093-83062115 TGTATTTTTTTGGTAGAGATGGG - Intergenic
935238371 2:101156902-101156924 TTTTTTGGTTTGGTAGAGATGGG - Intronic
936354085 2:111735342-111735364 TATATTGGTTTGGTTCAGAAAGG - Intergenic
936843814 2:116805424-116805446 TGCATTGGTTTGGTCCAGAAAGG - Intergenic
937074230 2:119089327-119089349 AGTCTTAGTTTTCTACAGATGGG - Intergenic
937190377 2:120090946-120090968 TGTTTTGGTTTACTGCAGAGTGG + Intronic
937399685 2:121571363-121571385 TGTTTTGCTTTGGTAGAGATGGG + Intronic
937551150 2:123094286-123094308 TACATTGGTTTGCTCCAGAAAGG + Intergenic
938002080 2:127750197-127750219 TGTATTTGTTTTGTACAAATGGG + Intronic
940092147 2:149932708-149932730 TGAAATGGTTTGCTAAAAATTGG - Intergenic
940225473 2:151396554-151396576 TGTATTTTTTTGGTAGAGATGGG - Intergenic
941465532 2:165821835-165821857 TGTATTTTTTTGGTAGAGATGGG - Intergenic
941755910 2:169185604-169185626 TGTATTGGATTGATACACAGAGG - Exonic
941811815 2:169762817-169762839 TGTATTTTTTTTGTACAGATGGG + Intronic
943268948 2:185773030-185773052 TGTATTTTTTTAGTACAGATGGG + Intronic
943758304 2:191582064-191582086 TGTATTTGTTTAGTAGAGATGGG + Intergenic
944525511 2:200614893-200614915 TATATTAGTTTGCTACTAATTGG - Intronic
944574902 2:201082123-201082145 TGTATTTTTTTGGTAGAGATGGG + Intronic
944725618 2:202468303-202468325 TTTATTGTTTTGGTAGAGATGGG - Intronic
944739610 2:202598975-202598997 TGTATTTGTTTGTTAGAGATGGG - Intergenic
944746228 2:202659481-202659503 TGTATTTGTTTTGTAGAGATGGG + Intronic
944829432 2:203518342-203518364 TGTATTGTTTTAGTAGAGATGGG - Intronic
945808642 2:214521048-214521070 TGTATTTGTTTAGTAGAGATGGG - Intronic
946256694 2:218447489-218447511 TGTATTTTTTTGGTAGAGATGGG + Intronic
946455570 2:219823081-219823103 TGTATTTTTTGGCTAGAGATGGG + Intergenic
947143214 2:227039338-227039360 TGTATTTTTTTAGTACAGATGGG + Intronic
947660755 2:231865076-231865098 TGTATTTTTTTAGTACAGATGGG + Intergenic
948435406 2:237950317-237950339 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1169307187 20:4502261-4502283 TGTGTGGGTTGGCTATAGATTGG + Intergenic
1169596533 20:7205908-7205930 TGTGTTAGTTTGCTATAGACTGG + Intergenic
1170465380 20:16618147-16618169 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1171217681 20:23363627-23363649 TTTATTGGTTTCCCACACATAGG - Intronic
1172737218 20:37135983-37136005 TGTATTTTTTTAATACAGATGGG + Intronic
1173694690 20:44998897-44998919 TGTATTGTTTTAGTAGAGATGGG - Intronic
1173886705 20:46465524-46465546 TGTTTTGGTTTTTTAGAGATGGG - Intergenic
1174428705 20:50451852-50451874 TGTATTTGTTTTGTAGAGATGGG - Intergenic
1174781766 20:53396108-53396130 TGTATTTTTTTAGTACAGATGGG + Intronic
1176587762 21:8605552-8605574 TGTATTGTTTTGTTAAATATAGG - Intergenic
1176676315 21:9781357-9781379 AGCATTGGATTGCTCCAGATCGG + Intergenic
1177153237 21:17475939-17475961 TGTATTTTTTTAGTACAGATGGG - Intergenic
1177173733 21:17681720-17681742 TATATTGGTTTGGTCCAGAAAGG + Intergenic
1177217562 21:18150051-18150073 TATATTGGTTTGGTCCAGAAAGG + Intronic
1178356275 21:31912714-31912736 TGTATTTGTTTGGTAGAGACGGG + Intronic
1179400833 21:41081544-41081566 TGCATTGGTTTGATCCAGAAAGG + Intergenic
1180216813 21:46328945-46328967 TGTATTTGTTTGGTTGAGATGGG + Intronic
1180254352 21:46613806-46613828 TGTATTTGTTTAATAGAGATGGG + Intergenic
1180256483 21:46633258-46633280 TGTATTTTTTTGGTAGAGATGGG - Intergenic
1180270592 22:10582551-10582573 TGTATTGTTTTGTTAAATATAGG - Intergenic
1180755479 22:18157984-18158006 TGTTTTTGTTTTTTACAGATAGG - Intronic
1182116401 22:27758997-27759019 TGTATTTTTTTTATACAGATGGG + Intronic
1182221903 22:28765333-28765355 TGTATTTTTTTGGTACAGACAGG + Intergenic
1182851257 22:33476435-33476457 TGCATTGGTTTGGTCCAGAAAGG - Intronic
1183557853 22:38545235-38545257 TGTATTTTTTTGGTAGAGATAGG - Intronic
1183644573 22:39116748-39116770 TATATTGGTTTGGTCCAGAAAGG - Intergenic
1183893951 22:40952281-40952303 TTTAGTGGTTTGCCACAGTTTGG + Intronic
1185261498 22:49867539-49867561 TGTTTTGTTTTGCCCCAGATCGG + Intronic
1185263129 22:49881975-49881997 CATCTTGCTTTGCTACAGATAGG + Intronic
949537064 3:5004534-5004556 TGGTTTGGTTTGGTAGAGATGGG - Intergenic
949616061 3:5754980-5755002 AGTATTGGTCTGCTATAAATTGG + Intergenic
949703709 3:6790099-6790121 TGAATGGGTTTGCTAAAGAGAGG + Intronic
950311640 3:11963589-11963611 TGTATTTTTTTGTTAGAGATGGG + Intergenic
950382737 3:12630975-12630997 TGTATTTTTTTGGTAGAGATGGG + Intronic
950795103 3:15504237-15504259 TGTATTGGTTTTCTAGGGCTGGG + Intronic
951214436 3:20010628-20010650 TGTATTTTTTTAGTACAGATGGG - Intronic
951535912 3:23740810-23740832 TGTTTTGGTTTGTTTCAGACAGG + Intergenic
951964933 3:28371650-28371672 TTTGTTGGTTTGCTTGAGATGGG - Intronic
952329228 3:32348670-32348692 TGTATTTTTTTGGTAGAGATGGG + Intronic
952630835 3:35464620-35464642 TGTTTTGGTTTGCTTTATATGGG + Intergenic
953292241 3:41677078-41677100 TGTATTTTTTTTCTAGAGATGGG + Intronic
954474806 3:50734325-50734347 TTTATTTTTTTGGTACAGATGGG - Intronic
955129110 3:56146113-56146135 TGTATTTTTTTGGTAGAGATGGG - Intronic
955612987 3:60777313-60777335 TGCATTGGTTTGGTTCAGAAAGG + Intronic
956500858 3:69883576-69883598 TGGATTGGTGGGCTACAGATTGG + Intronic
956827942 3:73016332-73016354 TGTTTTTGGTTGCTACAGTTTGG + Intronic
957390234 3:79556413-79556435 TGTACTGGTTTGCTAGTTATTGG + Intronic
957672167 3:83319351-83319373 TACATTGGTTTGCTTCAGAAAGG - Intergenic
957956409 3:87194389-87194411 TACATTGTTTTGCTTCAGATTGG - Intergenic
959011187 3:101078277-101078299 TGTATTTTTTTACTAGAGATGGG + Intergenic
959317559 3:104827014-104827036 TATATCTGCTTGCTACAGATAGG + Intergenic
959756195 3:109902557-109902579 TATATTGGTTTGGTTCAGAAAGG + Intergenic
960814312 3:121657642-121657664 TGTATTTTTTTGGTAGAGATGGG - Intronic
961470922 3:127111682-127111704 TATATTGGTTTGGTCCAGAAAGG - Intergenic
962040099 3:131698056-131698078 TGTATTTTTTTAGTACAGATGGG - Intronic
964856086 3:161147368-161147390 TACATTGGTTTGCTTCAGAAGGG + Intronic
966059881 3:175741930-175741952 TACATTGGTTTGTTACAGAAAGG + Intronic
966663401 3:182442055-182442077 TGTCTTGTTTTGTTATAGATTGG + Intergenic
968050746 3:195653397-195653419 TTTATATGTTTACTACAGATGGG + Intergenic
968105073 3:195994950-195994972 TTTATATGTTTACTACAGATGGG - Intergenic
968114504 3:196079439-196079461 TGTATTTTTTTGGTAGAGATGGG - Intronic
968243778 3:197120086-197120108 TGTATTTTTTTGGTAGAGATGGG - Intronic
968303372 3:197632541-197632563 TTTATATGTTTACTACAGATGGG - Intergenic
968363956 3:198171057-198171079 TGTCTGACTTTGCTACAGATTGG - Intergenic
968971877 4:3800058-3800080 TGTATTTTTTTGGTAGAGATGGG - Intergenic
969382356 4:6811614-6811636 TGTATTTTTTTGGTAGAGATGGG + Intronic
970599583 4:17630859-17630881 TGTATTGATTTTCCACAGAAAGG - Exonic
971211070 4:24616797-24616819 TGTATTGGTTTTTTAGAAATTGG - Intergenic
971753772 4:30682451-30682473 TGTATTATTTTGGTAGAGATGGG - Intergenic
972325460 4:38011178-38011200 TGTATTTTTTTGGTAGAGATGGG - Intronic
972619859 4:40736722-40736744 TGTATTTTTTTGGTAGAGATGGG - Intergenic
972717900 4:41666708-41666730 AGTAATAGTTTACTACAGATGGG - Intronic
972750853 4:41987317-41987339 TGTTTTTTTTTGGTACAGATGGG + Intergenic
973151062 4:46888617-46888639 TGTATTTTTTTACTAGAGATGGG + Intronic
973229027 4:47820627-47820649 GGTTTTGGTTTGCTTCTGATAGG - Intronic
973245957 4:48011701-48011723 TATATTGGTTTGGTCCAGAAAGG + Intronic
973843601 4:54888489-54888511 TGTCTTAGTTTGCTGCAGACTGG + Intergenic
974067120 4:57088856-57088878 TGTATTTTTTTGGTAGAGATGGG - Intronic
974221943 4:58986240-58986262 TGTATTCTTTTGGTACAGACGGG - Intergenic
974467402 4:62274570-62274592 TGTATTTTTTTGGTAGAGATGGG + Intergenic
974594937 4:64002248-64002270 TATTTTGGTTTGCTTCAGAAGGG + Intergenic
974868920 4:67614244-67614266 TGCATTGGTTTGGTTCAGAAAGG - Exonic
976681564 4:87761777-87761799 GGCATTGGTTTGCTAATGATCGG + Intergenic
976687131 4:87826410-87826432 TGTTTTTTTTTGCTAGAGATGGG + Intronic
978383694 4:108158324-108158346 AGTATTAGCTTCCTACAGATTGG + Intronic
978609790 4:110525232-110525254 TGAATTTGTTTCCTTCAGATGGG - Intronic
978687440 4:111463045-111463067 TGTATTGGTTTGCCCCAGTCTGG + Intergenic
980424019 4:132601561-132601583 TGTTTTGGTTTGCTATAGACTGG - Intergenic
980736688 4:136899503-136899525 TATATTGGTTTGGTACAGAAAGG + Intergenic
981103870 4:140858667-140858689 TGTTTTGTTTTGGTACAGACAGG - Intergenic
981156483 4:141442435-141442457 TGTTTTAGTTTTCTACAAATAGG + Intergenic
981470319 4:145126466-145126488 TGTATTTTTTTGATAGAGATGGG + Intronic
981682924 4:147421005-147421027 TATATTTGTTTGGTAGAGATGGG - Intergenic
982490145 4:156020026-156020048 TATATTGGTTTGGTCCAGAAAGG + Intergenic
982501268 4:156159360-156159382 GGTTTTGGTTTTCTTCAGATGGG - Intergenic
983816454 4:172134208-172134230 TGTATTGTTTTAGTAGAGATGGG - Intronic
984030961 4:174603597-174603619 TGTATTTGTTTTGTAGAGATGGG + Intergenic
984161606 4:176259452-176259474 TGTATTTGGTTGCTACTGAGGGG + Intronic
984553133 4:181184257-181184279 TGTATTGTTTTTGTAGAGATTGG - Intergenic
984797343 4:183674695-183674717 TGTTTTTGTTTTTTACAGATTGG + Exonic
985285145 4:188329570-188329592 TGCATTGGTTTGGTCCAGAAAGG + Intergenic
985399213 4:189577392-189577414 AGCATTGGATTGCTCCAGATCGG - Intergenic
985958102 5:3279422-3279444 TGTATTTTTTTAATACAGATGGG + Intergenic
985985539 5:3512898-3512920 TTCATTGGTTTGCTACTTATCGG + Intergenic
986718423 5:10540505-10540527 TGTATTTTTTTGGTAGAGATGGG - Intergenic
987586047 5:19858145-19858167 TATATTGGTTTGGTCCAGAAAGG + Intronic
987586182 5:19859719-19859741 TATATTGGTTTGGTCCAGAAAGG - Intronic
987786639 5:22508781-22508803 TACATTGGTTTGCTCCAGAAAGG - Intronic
988678486 5:33459303-33459325 TGTATTTGTGTGTTACATATAGG + Intronic
989042057 5:37239407-37239429 TGTATTTTTTTGGTAGAGATGGG - Intronic
989064339 5:37444512-37444534 TGTATTTTTTTGGTAGAGATGGG + Intronic
989165659 5:38431448-38431470 TCTATTGCTTAGCTACAAATGGG + Intronic
990089895 5:52030091-52030113 TGTATTTTTTTAGTACAGATGGG - Intronic
990585191 5:57204421-57204443 TGTATTTTTTTGATAGAGATCGG + Intronic
990922846 5:60986755-60986777 TGTATTTTTTTAGTACAGATGGG - Intronic
991094473 5:62724844-62724866 TGTATTGCTCTGATACATATGGG + Intergenic
992561246 5:77955021-77955043 TGTATTTTTTTGGTACAGATGGG - Intergenic
993125919 5:83835492-83835514 TGTATTTTTTTAGTACAGATGGG - Intergenic
993987370 5:94613368-94613390 TGTATTTTTTTGGTAGAGATGGG + Intronic
994122524 5:96132810-96132832 TCTATAGGTTTACTACAGCTGGG - Intergenic
994418148 5:99500351-99500373 TGTATTTTTTTGGTAGAGATGGG + Intergenic
994461815 5:100074799-100074821 TGTATTTTTTTGGTAGAGATGGG - Intergenic
995138315 5:108704668-108704690 TTTATTTTTTTGGTACAGATGGG - Intergenic
995663308 5:114510621-114510643 TATATTGGTTTGGTTCAGAAGGG - Intergenic
995740753 5:115353731-115353753 TATATTGGTTTGATCCAGAATGG + Intergenic
995973283 5:117999770-117999792 TGTTTTGTTTTGCTACACAATGG - Intergenic
995987807 5:118201277-118201299 TGTATTTTTTTGGTAGAGATGGG - Intergenic
997950027 5:138235092-138235114 TGTTTTGTTTTGTTAGAGATGGG + Intergenic
998275413 5:140747958-140747980 TGTATTTTTTTTATACAGATGGG + Intergenic
1000118397 5:158174620-158174642 TGTATTTTTTTAGTACAGATGGG - Intergenic
1001345019 5:170886832-170886854 TGTATTTTTTTTCTAGAGATGGG + Intronic
1004460932 6:15835276-15835298 TGTAGTGGTTGGCTACAAGTAGG - Intergenic
1005407683 6:25507943-25507965 TGTATTGGTTTATGATAGATTGG - Intronic
1005876643 6:30015539-30015561 TGTATTTTTTTGGTACAGACGGG - Intergenic
1007760597 6:44131298-44131320 TGTATCTCTTTGTTACAGATTGG + Intronic
1010452793 6:76021275-76021297 TACATTGGTTTGGTACAGAAAGG - Intronic
1010487141 6:76428501-76428523 TGTGGTGGTTTTCTACATATAGG + Intergenic
1012650164 6:101742578-101742600 TGCATTGGTTTGGTCCAGAAAGG + Intronic
1013165185 6:107583702-107583724 TGTTTTGTTTTGGTAGAGATGGG + Intronic
1013565221 6:111352335-111352357 TGTATTTGTTTGATACAAGTGGG + Intronic
1013585769 6:111577560-111577582 TGTATTATTTTGGTAGAGATGGG + Intronic
1015482176 6:133724425-133724447 TATATTGCTTTGGTACATATGGG - Intergenic
1016719877 6:147283689-147283711 TGTATAGTTTTGCTGCAGGTTGG - Intronic
1017437044 6:154425497-154425519 TGTGTTGGTTTGCTGCAGAAGGG + Intronic
1017578791 6:155837091-155837113 TGTATTGTTTTAGTACAGACAGG - Intergenic
1017664049 6:156702011-156702033 TGTATTAGTTTCCTACAGGTTGG + Intergenic
1017834031 6:158160354-158160376 AGTATTTGTTTGCCACAGATTGG - Intronic
1018987193 6:168646901-168646923 TTCATTGTTTTGCCACAGATTGG + Intronic
1019131075 6:169875479-169875501 TGTGTTCTTTTGCTTCAGATAGG + Intergenic
1021601642 7:22370153-22370175 TGTATTTTTTTAGTACAGATGGG - Intergenic
1022284115 7:28938799-28938821 TTAATTGGTTTGCTAGAGTTTGG - Intergenic
1022390311 7:29938200-29938222 TGTATTTTTTTGGTAGAGATGGG + Intronic
1022862995 7:34387489-34387511 TATATTGGTTTGGTACAGAAAGG + Intergenic
1022985421 7:35649600-35649622 TATATTGGTTTGGTCCAGAAAGG + Intronic
1023096260 7:36662649-36662671 TGTCCTGGATTGCCACAGATGGG - Intronic
1023308599 7:38857854-38857876 TATATTGGTTTGGTCCAGAAAGG + Intronic
1026640953 7:72125184-72125206 TGTATTTTTTTGGTAGAGATGGG + Intronic
1027009248 7:74728126-74728148 TGTATTTTTTTGATAGAGATGGG - Intronic
1027057272 7:75058400-75058422 TGTATTTTTTTGGTAGAGATGGG + Intronic
1027387194 7:77670444-77670466 TGTATTTCTTTACTAGAGATGGG - Intergenic
1027563704 7:79764683-79764705 TGTATTAATTTGCTACAGTAAGG - Intergenic
1028281728 7:88938066-88938088 TATATTGGTTTGGTCCAGAAAGG + Intronic
1030024453 7:105309585-105309607 TTTGGTGGTTTGCCACAGATTGG - Intronic
1031647442 7:124243878-124243900 TTTTTTTGTTTGTTACAGATAGG + Intergenic
1032420343 7:131774296-131774318 TGCATTGGTTTGGTCCAGAAAGG - Intergenic
1032478975 7:132231594-132231616 TGTATTTTTTTGGTAGAGATGGG + Intronic
1033020496 7:137719673-137719695 GTTACTGGTTTACTACAGATGGG + Intronic
1033162887 7:139012916-139012938 TGCATTGGTTTGGTCCAGAAAGG - Intergenic
1034824091 7:154245122-154245144 TGTATTTTTTTGGTAGAGATGGG + Intronic
1035213191 7:157344165-157344187 TGTATTGTTTTAGTAGAGATGGG - Intronic
1035530012 8:343972-343994 TATCTGGGTTTGCTAGAGATGGG + Intergenic
1035961228 8:4140323-4140345 TGTATTGTTTTAGTAGAGATGGG - Intronic
1036196096 8:6716385-6716407 TGTATTTTTTTGGTAGAGATGGG - Intronic
1036385842 8:8280548-8280570 TGTCTAGGTGTGCTACATATTGG + Intergenic
1036941181 8:13054142-13054164 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1037049700 8:14356645-14356667 TGAGTTGGTTTGCTTCATATGGG - Intronic
1037100198 8:15033795-15033817 TTGATTGGGTTGGTACAGATGGG - Intronic
1038687946 8:29735534-29735556 TGTATTGTTTTAGTAGAGATGGG - Intergenic
1038902652 8:31861305-31861327 TGTGTTGGTGTGACACAGATGGG + Intronic
1040454914 8:47587430-47587452 TGTATTTTTTTGGTAGAGATGGG - Intronic
1041083984 8:54240322-54240344 TGTATTTTTTTGGTACAGACAGG - Intergenic
1042320722 8:67472597-67472619 TGTATTTTTTTGGTACAGACAGG + Intronic
1042745422 8:72101376-72101398 TGTATTGGTTAGCCACAGTGGGG + Intronic
1042756973 8:72225369-72225391 TGTATTCATTTTTTACAGATGGG - Intergenic
1044672347 8:94695525-94695547 TGTATTTTTTTGGTAGAGATGGG + Intronic
1045138065 8:99245713-99245735 TCTATTGTTTTAGTACAGATAGG + Intronic
1045350484 8:101333620-101333642 TGCAGTGATTTGCTAAAGATAGG - Intergenic
1045936935 8:107690784-107690806 TGTTTTTGTTTGGTAGAGATGGG - Intergenic
1049706082 8:144043164-144043186 TGTATTTTTTTGGTAGAGATGGG + Intronic
1051631939 9:19148547-19148569 TGTATTTGTTTAGTAGAGATGGG - Intronic
1051690151 9:19703732-19703754 TGTCTTGGTTCACTGCAGATAGG + Intronic
1051967990 9:22852344-22852366 TGTATTTTTTTGGTACAGATTGG - Intergenic
1055121651 9:72666876-72666898 TGTTTTGTTTTGGTAGAGATGGG - Intronic
1056921242 9:90791075-90791097 TGTATTGGTTTGGTCCAGAACGG + Intergenic
1057300467 9:93876756-93876778 TGTTTTGCTTTGTTAAAGATAGG - Intergenic
1057539795 9:95956404-95956426 TGTAATGGTTTACCACAAATGGG + Intronic
1058201036 9:102040787-102040809 TGTATTGTTTTAATAGAGATGGG + Intergenic
1059164508 9:112065349-112065371 TGTATTTTTTTACTAGAGATGGG - Intronic
1059489173 9:114653029-114653051 TGTTTTGTTTTGGTAGAGATCGG + Intergenic
1060310592 9:122457093-122457115 TGTGTTAGTTTGCTGAAGATTGG - Intergenic
1060508862 9:124217892-124217914 TGTATTCTGTTTCTACAGATGGG + Intergenic
1060579973 9:124736670-124736692 TGTATTTTTTTGGTAGAGATAGG - Intronic
1203617725 Un_KI270749v1:83738-83760 TGTATTGTTTTGTTAAATATAGG - Intergenic
1186133319 X:6493176-6493198 TGTATTATTTTGGTACAGACGGG + Intergenic
1186487568 X:9945280-9945302 TGTATTTTTTTGGTAGAGATGGG + Intronic
1186662293 X:11680865-11680887 TGTATTGTTTTTGTAGAGATGGG + Intergenic
1187057297 X:15753024-15753046 TGCATTGGTTTGGTCCAGAAAGG - Intronic
1188390309 X:29611441-29611463 TACATTGGTTTGGTACAGAAAGG - Intronic
1189196380 X:39156870-39156892 AGTATTAGTCTGCTACACATTGG - Intergenic
1189517071 X:41723866-41723888 TGTATTGGGTTACTACAGAGTGG + Intronic
1190785443 X:53643521-53643543 TGTATTGTTTTAGTAGAGATGGG + Intronic
1191830887 X:65415057-65415079 TACATTGGTTTGCTCCAGAAAGG + Intronic
1192331960 X:70182827-70182849 TGTATTTTTTTAGTACAGATGGG + Intronic
1193660163 X:84247842-84247864 TGCATTGGTTTGGTCCAGAAAGG + Intergenic
1195487834 X:105430093-105430115 TGTGTTGGTTAACTACAGACAGG - Intronic
1195924179 X:110009199-110009221 TTTATTCCTTTGCCACAGATGGG + Intronic
1196484481 X:116189031-116189053 GCTATTGGTTTGCCATAGATGGG + Intergenic
1198232474 X:134704817-134704839 TGTATTTTTTTGGTAGAGATGGG - Intronic
1198258497 X:134945904-134945926 TGCATTGGTTTGGTCCAGAAAGG - Intergenic
1198531640 X:137554136-137554158 TGTATTGTTTTAGTAGAGATGGG + Intergenic
1198711225 X:139506674-139506696 AGTATATTTTTGCTACAGATGGG - Intergenic
1198839997 X:140846259-140846281 TATATTGGTTTTGTAGAGATGGG + Intergenic
1200834013 Y:7715256-7715278 TTTATTTGTTTGTTAGAGATGGG + Intergenic
1201483952 Y:14471982-14472004 TCTTTTGGATTGCTACAAATTGG - Intergenic
1201694494 Y:16809963-16809985 TATATTGGTTTGCTCCAGAAAGG - Intergenic