ID: 1157120100

View in Genome Browser
Species Human (GRCh38)
Location 18:44901159-44901181
Sequence GAACCCATCAAAGCAAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157120100_1157120101 10 Left 1157120100 18:44901159-44901181 CCAACTCTTGCTTTGATGGGTTC 0: 1
1: 1
2: 0
3: 12
4: 125
Right 1157120101 18:44901192-44901214 ACCCTACCCTGCCTAGCATGAGG 0: 1
1: 0
2: 2
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157120100 Original CRISPR GAACCCATCAAAGCAAGAGT TGG (reversed) Intronic
901648344 1:10728564-10728586 GAAGCCAAGAAAGAAAGAGTTGG - Intronic
902652838 1:17847719-17847741 GGATCCAGCAAAGCAAGACTTGG - Intergenic
905012591 1:34757512-34757534 GAACTCATCAAAGCAGACGTTGG - Exonic
906410246 1:45573242-45573264 CAACACAGCAAAGCAAGAGAGGG + Intergenic
908549274 1:65192933-65192955 GAACCCAGCAAAGCCACAGAGGG - Intronic
911247736 1:95537225-95537247 GAGCCCATCAGAGCAGGAGATGG - Intergenic
911521378 1:98934183-98934205 GTTCCCAGAAAAGCAAGAGTTGG - Intronic
917002432 1:170374755-170374777 GAAACCTTCAAAGCCAGAGGTGG - Intergenic
919668030 1:200311315-200311337 CAAGACATCAGAGCAAGAGTGGG - Intergenic
922455964 1:225773751-225773773 GAACCCATGAAAGCAACTTTGGG + Intergenic
1063616020 10:7601201-7601223 GACCACATCTAAGCAAAAGTGGG + Intronic
1065650710 10:27887775-27887797 AAATCAATGAAAGCAAGAGTTGG + Intronic
1070357335 10:75653071-75653093 GAGTCCATTAAAGCCAGAGTGGG - Intronic
1072901465 10:99411183-99411205 GAGGCAATCAAAGCGAGAGTGGG + Intronic
1075547012 10:123362742-123362764 GCACTCATTAAAGCAAGAGAGGG + Intergenic
1075950399 10:126472610-126472632 GTACCCAGGAAAGCAAGAATGGG - Intronic
1080939456 11:36898935-36898957 GAACCCATAGAAGCAGGAATAGG + Intergenic
1081045092 11:38264250-38264272 GATCCCAACAAAGCCAGAGTAGG - Intergenic
1084347464 11:68564376-68564398 GAAGCCATCAGAGGAAGACTTGG + Exonic
1091234648 11:134013020-134013042 GAAAACATCAAGGCCAGAGTTGG + Intergenic
1092765136 12:11846141-11846163 GAACCCATCAAAGGCAGAAAGGG + Intronic
1098948856 12:76618398-76618420 GAAGCCTTCAAAGAAAGGGTGGG + Intergenic
1101279070 12:103232323-103232345 CAATCCATAAAAGAAAGAGTCGG - Intergenic
1105268179 13:18841600-18841622 TAACCCAACAAAGAAAGATTAGG - Intergenic
1105540115 13:21308904-21308926 GAACCCATCAAAGCAAGAGGTGG - Intergenic
1106943887 13:34803839-34803861 GCATCCATCAAAACTAGAGTTGG + Intergenic
1107149043 13:37090945-37090967 GGACCCATCTAAGCAAGTGAAGG + Intergenic
1109965589 13:69690136-69690158 GAAAGCATCAAATGAAGAGTTGG - Intergenic
1110949486 13:81466897-81466919 GATCCCATGAAAACAAGTGTGGG - Intergenic
1118281907 14:64436973-64436995 CAACACATTACAGCAAGAGTGGG + Intronic
1121573217 14:94962907-94962929 GAAGCCATCAAATCATGAATTGG + Intergenic
1122931686 14:104935944-104935966 GAACCCAACAAAGCCACACTTGG + Exonic
1130410510 15:83644225-83644247 TTAACCATCAAAGCAAGAGTGGG - Intergenic
1131153287 15:90060033-90060055 GGACCCAACAGAGCAAGAGCGGG - Intronic
1131994891 15:98124315-98124337 GAACCCATCAAAACACGTTTGGG - Intergenic
1137657772 16:50175307-50175329 AAATCCATCAAAGAAAGAATTGG - Intronic
1138028801 16:53542723-53542745 GAATCCATCAAGAGAAGAGTTGG + Intergenic
1140633202 16:76879774-76879796 GAACACATGAAAGCGAGTGTTGG - Intergenic
1154419842 18:14218446-14218468 TAACCCAACAAAGAAAGATTGGG + Intergenic
1156447505 18:37248520-37248542 GAAGTCAGCAGAGCAAGAGTGGG - Intronic
1157039136 18:44017676-44017698 GAATCCATGAAACCAAAAGTTGG + Intergenic
1157120100 18:44901159-44901181 GAACCCATCAAAGCAAGAGTTGG - Intronic
1157191722 18:45587597-45587619 GAACCTTTCAAGGCACGAGTTGG + Intronic
1166855942 19:45782623-45782645 GAACCCTTCAGTGCTAGAGTAGG + Intronic
1167949379 19:53014203-53014225 GAAACCATCTAAGCAACTGTTGG + Exonic
1167953947 19:53049364-53049386 GAAACCATCTAAGCAACTGTTGG + Exonic
927098462 2:19766809-19766831 GAATCAATAAAAGCAAAAGTTGG + Intergenic
929096677 2:38268916-38268938 AAACCCATCAAACCAAGAGATGG + Intergenic
930241563 2:48940921-48940943 GAACTCTTCATAGCAAAAGTAGG - Intergenic
930891752 2:56397518-56397540 AAATCAATCAAAGCAAGAGCTGG - Intergenic
931766076 2:65457582-65457604 GAACCTATTAAAGGTAGAGTTGG + Intergenic
934497395 2:94818811-94818833 TAACCCAACAAAGAAAGATTGGG - Intergenic
936828748 2:116613591-116613613 GAAACCATGAAAGCAAAAGCTGG + Intergenic
936884535 2:117294299-117294321 GAAACCATCAAAGCCAGAAGAGG + Intergenic
939361289 2:141175818-141175840 CAACCCATGAAAGCAACTGTGGG + Intronic
940079114 2:149779925-149779947 GACTCCATCAAAGAAAGAGAAGG - Intergenic
943074655 2:183179473-183179495 GAACCCAGCAAGCTAAGAGTGGG + Intergenic
943483400 2:188450796-188450818 GGACCCACAGAAGCAAGAGTAGG + Intronic
944874837 2:203951818-203951840 ATACGCATCAAAGCAACAGTGGG + Intronic
945545790 2:211149606-211149628 AAACCAATTAAAGCAATAGTAGG + Intergenic
946006879 2:216532923-216532945 TAACTCATTAAAGGAAGAGTTGG + Intronic
946180863 2:217948228-217948250 CCACCCATCACAGGAAGAGTTGG - Intronic
1170108351 20:12777454-12777476 GAACTCATTAAAGGTAGAGTAGG + Intergenic
1170560408 20:17552337-17552359 GAGGCCATCATGGCAAGAGTGGG + Intronic
1171299220 20:24044973-24044995 GAACCTATTAAGGCACGAGTAGG - Intergenic
1173495650 20:43515379-43515401 GAGCCCATCAGAGGAGGAGTCGG + Exonic
1173650846 20:44663124-44663146 CCACCCTTCAAAGCAAGAGGAGG + Intergenic
1176853454 21:13940865-13940887 TAACCCAACAAAGAAAGATTGGG - Intergenic
1179085958 21:38218030-38218052 GAACCATACAAAGCAAGAGTGGG - Intronic
950997960 3:17525062-17525084 GAAACCAACAAAGCATGAGGAGG + Intronic
955359689 3:58262743-58262765 GATCCCCTCAACGAAAGAGTAGG - Intronic
956402622 3:68896355-68896377 GCAGCCATCCAAGCAAGAGATGG + Intronic
958019111 3:87977147-87977169 GATCCCATCAAAGGAAGACTGGG + Intergenic
958724829 3:97891998-97892020 GATCCCGTCAAAGCAAAAGCAGG - Intronic
965762738 3:172096900-172096922 GAACCCATAAAGATAAGAGTGGG + Intronic
969139566 4:5056672-5056694 GAGCCCATCAAAGTAACCGTGGG - Intronic
970568226 4:17353288-17353310 GAACCCAGCAAAGCAGCAGCTGG + Intergenic
972792623 4:42387552-42387574 GCACCCATGAAAGCCAGAGTGGG + Intergenic
973725861 4:53774948-53774970 GAACCCACAAGAGCAAGAGAAGG - Intronic
976374833 4:84333791-84333813 GAATCAATGAAACCAAGAGTTGG - Intergenic
976742478 4:88370296-88370318 GAAGCCCTCATAGCAAGAGGCGG + Intergenic
984313351 4:178092429-178092451 GATCCCATGAAATCAGGAGTTGG + Intergenic
993751461 5:91673571-91673593 CAACCCATCAAAGAAAGAAATGG + Intergenic
995169740 5:109093330-109093352 GAACACATTGCAGCAAGAGTTGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999477131 5:151910801-151910823 AAACCCAATAAAGCAAGAGAGGG - Intronic
999636823 5:153631867-153631889 GAAGCCAGCCAAGCAAAAGTAGG + Intronic
1000278779 5:159764059-159764081 GTACCCATCAGATCAAGAGTAGG - Intergenic
1001879447 5:175230731-175230753 GAAACCATCAAAGGAAGAAGGGG + Intergenic
1007106011 6:39283442-39283464 GAACCTTTCCAATCAAGAGTTGG + Intergenic
1007504573 6:42325658-42325680 GAACCCAGGAAATCAAGACTAGG + Intronic
1008130210 6:47712704-47712726 GCAACCATCAAAGCAACAGCAGG + Intronic
1008866400 6:56216115-56216137 GAAGCCATCAGAGAAAGTGTAGG - Intronic
1010705708 6:79106972-79106994 GGACTCATGAAAGCAATAGTTGG + Intergenic
1012323023 6:97875992-97876014 AAATCCACAAAAGCAAGAGTTGG - Intergenic
1013680275 6:112517784-112517806 GCACCCCCCCAAGCAAGAGTAGG + Intergenic
1015428809 6:133105498-133105520 GAAACGATGAAAGCAAGAGCAGG + Intergenic
1016089176 6:139954698-139954720 AAAACCATCAAAGCAAGAGGAGG - Intergenic
1018784772 6:167099417-167099439 GGACACATAAAAGCAAGAGAAGG - Intergenic
1019319077 7:407097-407119 GAGTCCATCAAGGCATGAGTGGG + Intergenic
1021699987 7:23308744-23308766 GAAACCATCAGAGCAAAAGTAGG - Intronic
1022015962 7:26348483-26348505 GAACCAGCCAAAGCAAGAGCTGG + Intronic
1023370720 7:39509673-39509695 GAACTCATCAAAGGAAGGGATGG - Intergenic
1025003772 7:55339774-55339796 GAAACAATCCAAGCAAGAGTAGG + Intergenic
1030476898 7:110046842-110046864 AAACCCATGTATGCAAGAGTGGG - Intergenic
1032422865 7:131797034-131797056 GAACCAATAAAATCAAGAGCAGG - Intergenic
1032705832 7:134420641-134420663 GAAACCATCAACACAAAAGTAGG + Intergenic
1033876985 7:145833478-145833500 CAACCCATCAGAGGATGAGTAGG - Intergenic
1035372218 7:158386785-158386807 GAAACCACCACAGCAAGAGCTGG - Intronic
1037171931 8:15903362-15903384 GAAGTAATCAAAGAAAGAGTGGG + Intergenic
1038133882 8:24765177-24765199 GAACCCATGAAAGAAAGCCTAGG - Intergenic
1039659365 8:39446537-39446559 GCACCCATCTTAGCAAGAGGGGG + Intergenic
1040838450 8:51757749-51757771 GAAACAATGAAAGAAAGAGTAGG - Intronic
1041798657 8:61773683-61773705 GAACCCATCATTGCCAGTGTTGG - Intergenic
1042460351 8:69058443-69058465 GCACCAATCTAAGCAAGGGTTGG + Intergenic
1045058047 8:98385902-98385924 GAACCCATGAAAGCATGAAGTGG - Intergenic
1046073302 8:109284861-109284883 GAATCCATGAAACCAAAAGTTGG + Intronic
1048664057 8:136641413-136641435 CAACTCATCAAAGCAAGGCTAGG + Intergenic
1048762474 8:137810683-137810705 GAAGCCAACAAAGCAAGGGTTGG - Intergenic
1051680506 9:19603072-19603094 GAAACCATCCATGCAACAGTTGG + Intronic
1053659755 9:40261640-40261662 TAACCCAACAAAGAAAGATTGGG + Exonic
1053910126 9:42890997-42891019 TAACCCAACAAAGAAAGATTGGG + Intergenic
1054371884 9:64407936-64407958 TAACCCAACAAAGAAAGATTGGG + Exonic
1054524843 9:66114577-66114599 TAACCCAACAAAGAAAGATTGGG - Exonic
1054679504 9:67897650-67897672 TAACCCAACAAAGAAAGATTGGG + Exonic
1057229917 9:93315040-93315062 GGTCCCATCAGAGCAAAAGTGGG - Intronic
1062516229 9:136937947-136937969 GAACCCATCAGAGCCAAACTTGG - Intronic
1190148433 X:47920081-47920103 GAATCCATCTAATCAGGAGTTGG + Exonic
1190936288 X:55001432-55001454 GCACACATCAGAGCCAGAGTTGG - Intronic
1191577515 X:62722788-62722810 CAACCCATCAAATCAAAAGAAGG + Intergenic
1194108308 X:89798996-89799018 GAGCCCATCAAAGCAAACGAGGG + Intergenic
1195205033 X:102590074-102590096 GTACCTATCAAAGGAAGAATGGG + Intergenic
1195206855 X:102609721-102609743 GAACCAATGAAACCAAAAGTTGG - Intergenic
1195331007 X:103800404-103800426 GAACCCAACAAAGTAAGAGGTGG - Intergenic
1198668577 X:139052737-139052759 GAAGCGGTCAAAGCAAAAGTAGG - Intronic
1199384375 X:147206924-147206946 GAACAACTCAAAGCAAAAGTGGG + Intergenic
1201547351 Y:15180273-15180295 GAAGGCATCAAAGCATGAATTGG - Intergenic
1201592580 Y:15631564-15631586 AAACCCATGAAAGTAAAAGTTGG - Intergenic
1201979206 Y:19889592-19889614 GAACCCATCAAATGTAGATTTGG + Intergenic