ID: 1157124487

View in Genome Browser
Species Human (GRCh38)
Location 18:44943172-44943194
Sequence CTCCTGTTCATGAGCATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157124487 Original CRISPR CTCCTGTTCATGAGCATAAA TGG Intronic
900009622 1:94385-94407 CTCCTGTTCATGTTGATACACGG - Intergenic
900025732 1:270962-270984 CTCCTGTTCATGTTGATACACGG - Intergenic
900035497 1:404724-404746 CTCCTGTTCATGTTGATACACGG - Intergenic
900057118 1:640474-640496 CTCCTGTTCATGTTGATACACGG - Intergenic
901412299 1:9092983-9093005 CTCCTATACATGAGTACAAAGGG - Intergenic
902760083 1:18575380-18575402 CTCCTTTTCATGAGCAGAAAGGG - Intergenic
909293848 1:73919210-73919232 CTCTTGATCATTTGCATAAAAGG - Intergenic
909557121 1:76966221-76966243 TTCCTATTCATGAGCATGGAAGG + Intronic
910313410 1:85854585-85854607 TTCCTATCCATGAGCATAGAAGG + Intronic
911460656 1:98185565-98185587 CTCCAGTTGATGAGCACTAATGG + Intergenic
912541435 1:110419176-110419198 CTCCTGTTGATGAGGGGAAATGG - Intergenic
914336068 1:146715990-146716012 CACCTGTTCCTGAGGGTAAAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918242641 1:182634054-182634076 CTCCTGTCCCTGAGCCTGAAGGG - Intergenic
919700375 1:200625359-200625381 CTCATGTTCGTGGGTATAAAAGG + Intronic
922258035 1:223910279-223910301 CTCCTGTTCATGTTGATACACGG - Intergenic
922330339 1:224569503-224569525 CTCCTGTACGTGTGCACAAAGGG - Intronic
924339229 1:243013058-243013080 CTCCTGTTCATGTTGATACACGG - Intergenic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1064956233 10:20913860-20913882 CTCCAGTTTTTGAACATAAATGG - Intronic
1065299352 10:24307290-24307312 CTTGTGTTCATGAGCAGAGAAGG + Intronic
1073737577 10:106367445-106367467 CTCCTCTTCTTGAGTATGAATGG - Intergenic
1081766376 11:45613659-45613681 GTCCAGTTCATGAACATTAATGG + Intergenic
1082672598 11:56053867-56053889 CTCATTTTCATGAGCTTAAATGG + Intergenic
1088989375 11:114938661-114938683 CTCATGCACATGAGCATAAGTGG - Intergenic
1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG + Intergenic
1090833341 11:130435679-130435701 CTCCTGTTCATGAGAACAGAAGG - Intergenic
1091656529 12:2350597-2350619 CTTCAGTTCATGGGCATCAATGG - Intronic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1097785562 12:63755165-63755187 CTCCTTTTCATGTGGATGAAGGG - Intergenic
1101502411 12:105316488-105316510 CTGTTGTTCAGGATCATAAAAGG - Intronic
1104239574 12:126974917-126974939 CTCATGTTGAGGAGCATAAACGG + Intergenic
1112999901 13:105622490-105622512 ATCCTATTAATGAGCATAAATGG - Intergenic
1113423459 13:110187883-110187905 ATTCTGGGCATGAGCATAAAAGG - Intronic
1113748761 13:112764468-112764490 CTCCTGATGATGAGCAGAACAGG + Intronic
1116429068 14:44824986-44825008 TTCCTGTCCATGAGCATGGAAGG - Intergenic
1119034931 14:71221578-71221600 GCCCTGGTCATGAGAATAAATGG + Intergenic
1122473841 14:101991889-101991911 CTCCTGTCCATGAGCATCTTTGG + Intronic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1125309544 15:38363479-38363501 CTCCTTTGCAGGAACATAAATGG - Intergenic
1126038406 15:44568620-44568642 TTCCTGTTCATCATCATAAATGG + Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1129124498 15:73426906-73426928 CTCTGGTTCCTGAGCATTAAAGG + Intergenic
1129584568 15:76849417-76849439 CTCCTGTTCATCAACAGACAGGG + Intronic
1130822053 15:87506226-87506248 CTCCTCTTCATGACCATCAGAGG + Intergenic
1132712857 16:1277014-1277036 CTCCTGTGGCTGAGGATAAAGGG - Intergenic
1134647253 16:15879108-15879130 CTCCTTTTCAAGAGCATAGTTGG + Intronic
1136650188 16:31662436-31662458 CAACTGTTCATGAGGGTAAAGGG - Intergenic
1138369258 16:56512072-56512094 CACCTTTTCTTGTGCATAAATGG - Intronic
1139641062 16:68291741-68291763 CTCCTTCTCATGGGCATATAGGG + Intronic
1139997554 16:70995229-70995251 CACCTGTTCCTGAGGGTAAAAGG - Intronic
1140888668 16:79266844-79266866 CTCCTCTTCATGAGCATTACTGG - Intergenic
1141013780 16:80428280-80428302 CACCTGTTATTGAGCATTAAAGG - Intergenic
1142454707 16:90212517-90212539 CTCCTGTTCATGTTGATACACGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG + Intergenic
1149854579 17:60069428-60069450 CTCCTGGTCTTGAGCATCATGGG + Intronic
1153471006 18:5445385-5445407 CTCCTGTTTAAGTGCAAAAATGG + Intronic
1156387628 18:36620244-36620266 CTCCTGTTTTTGAACATGAAAGG + Intronic
1156868678 18:41917902-41917924 CTACTGTTCGTTAGAATAAATGG - Intergenic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1158420466 18:57288569-57288591 ATCATGTTCATCAGCATGAAGGG - Intergenic
1158541579 18:58360980-58361002 CTTCTGTCCAGGACCATAAATGG - Intronic
1159069206 18:63604781-63604803 CTCCAGTTCTTGAGCATCAGAGG - Intergenic
1164077297 19:21831909-21831931 TTTCTATTCATGAGCATAAACGG - Intronic
1164771356 19:30811837-30811859 CCCCTGCTAATGTGCATAAATGG + Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1166420883 19:42635081-42635103 CTCCTGCTAAGGAGCAAAAAGGG - Intronic
1168496478 19:56855541-56855563 CTCATTTTCATGAGTGTAAATGG + Intergenic
927009230 2:18884881-18884903 CTACTGTTCATTAGCACAATTGG + Intergenic
930309441 2:49719925-49719947 TTCCTGTTCATAAGGATAGAAGG + Intergenic
930347917 2:50208601-50208623 CTCCTGTCCATGAGCCTGCAGGG + Intronic
931470274 2:62532299-62532321 CTGGTGTTTATGAGCCTAAATGG + Intergenic
931497291 2:62822203-62822225 TCTCTGTACATGAGCATAAAGGG - Intronic
932080681 2:68711743-68711765 CTCATGTTCTTGCTCATAAATGG - Intronic
932937590 2:76123426-76123448 TTCATTTTCATGAGCATAAAAGG - Intergenic
933076150 2:77929547-77929569 CACTTGTTCCTGATCATAAAAGG + Intergenic
937762767 2:125625890-125625912 TTCCTATCCATGAGCATCAAAGG - Intergenic
938200319 2:129367302-129367324 CTCCACTGCATGAGGATAAAGGG + Intergenic
938653969 2:133411977-133411999 CTCCTGTTCATCTGCATATCAGG + Intronic
939695915 2:145324394-145324416 TACTTGTTCATTAGCATAAAAGG + Intergenic
940829728 2:158454400-158454422 CTCATGTTTAGGAGCATAAGTGG + Intronic
941220065 2:162767124-162767146 ATCATATTCATGGGCATAAATGG + Intronic
941233420 2:162939797-162939819 CTTCTGCTCATCAGCATAGATGG - Intergenic
944201899 2:197116637-197116659 CTCCTGTTCCTAAGAGTAAAGGG + Intronic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944501921 2:200370285-200370307 TTCCTGTTCAATAGAATAAATGG + Intronic
945115440 2:206403785-206403807 CCCCTGTTATTGAACATAAAAGG - Intergenic
945191484 2:207192412-207192434 GTCCTTTTCAGGAACATAAATGG - Intergenic
945668762 2:212776379-212776401 CTGCTGTTCATTAACATGAAAGG + Intergenic
949086168 2:242157176-242157198 CTCCTGTTCATGTTGATACACGG + Intergenic
1169759220 20:9073308-9073330 CTCCTGTTCTAGAGAAGAAAGGG - Intronic
1175329078 20:58150338-58150360 ATACTGTTCAGGAGCAGAAATGG + Intergenic
1177241632 21:18465783-18465805 TTCCTATCCATGAGCATAGAAGG - Intronic
1180415430 22:12706540-12706562 CGCATGTTCATGAGATTAAAGGG - Intergenic
1181714085 22:24711796-24711818 CTCATGTCCAGGAGGATAAAGGG - Intergenic
1182795570 22:32989329-32989351 CTCCTGTGCATCAGCATGATGGG + Intronic
959111225 3:102124795-102124817 CTTCAGTTCAGCAGCATAAAGGG - Intronic
962404339 3:135087531-135087553 CTGCTGCCCATCAGCATAAAGGG - Intronic
964032022 3:152149126-152149148 CTTCTGTTCATAAGGATGAAAGG - Intergenic
966953738 3:184850666-184850688 CCCATGTTCAGAAGCATAAAAGG + Intronic
969935391 4:10674915-10674937 TTCATGTTCATGAGAATACATGG + Intronic
971183906 4:24355397-24355419 CTCCTCTTCTTGACAATAAAAGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
973237245 4:47918659-47918681 TTCCTATCCATGAGCATAGAAGG + Intronic
974806976 4:66893499-66893521 CTCATTTTTATGAGCATACACGG + Intergenic
977088978 4:92645855-92645877 CTCCTGTTGATGAACATTGATGG + Intronic
979237893 4:118422164-118422186 CTCCTGTTCATGTTGATACACGG + Intergenic
980513491 4:133823743-133823765 CTCCTGGTTATGTTCATAAAAGG - Intergenic
983551794 4:169025289-169025311 TTCCTGGTCATGCCCATAAAAGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985826954 5:2199679-2199701 GTCATGTTCACAAGCATAAAAGG - Intergenic
987033198 5:13994658-13994680 CTTCTGCTCATAAGCTTAAACGG + Intergenic
989437651 5:41433583-41433605 CTCCTGTGCCTGAGCAAACATGG - Intronic
990584295 5:57195374-57195396 CTCCAGGTCCTGGGCATAAATGG + Intronic
991535214 5:67662437-67662459 TTCCTATCCATGAGCATAGAAGG + Intergenic
993101834 5:83550262-83550284 CTCCTGTTCATGAACATAGAAGG - Intronic
994833674 5:104819908-104819930 CTCCTGTGGGTGAGCATACACGG + Intergenic
995275109 5:110268856-110268878 TTACTGTTCATCAGAATAAATGG + Intergenic
995930306 5:117433927-117433949 CTCCTGTTCATTCCCCTAAATGG + Intergenic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
997435080 5:133868062-133868084 ATCCTGTTCATGACCTCAAAAGG + Intergenic
999941724 5:156550339-156550361 TTTCTTTTCATGAGCAGAAAGGG + Intronic
1000283951 5:159810324-159810346 CTTCTGGTCATGATCTTAAAGGG - Intergenic
1001580432 5:172794445-172794467 CTCCTGTTCATGACCATTGATGG - Intergenic
1001782686 5:174383772-174383794 CCACTGGTCATGAGCTTAAATGG + Intergenic
1002657706 5:180765096-180765118 TTCCTATTCATGAGCATGAAAGG - Intergenic
1002738322 5:181414147-181414169 CTCCTGTTCATGTTGATACACGG + Intergenic
1004090405 6:12494687-12494709 CTCATGTGAATGAGCACAAAGGG + Intergenic
1010077514 6:71817581-71817603 TTCCTGTCCATGAGCATGGAAGG + Intergenic
1010346481 6:74816109-74816131 CTCCTGTGCATGAGCTAAAGTGG + Intergenic
1012172257 6:96032159-96032181 CTCCTGTAGATTATCATAAAAGG - Intronic
1014590274 6:123257754-123257776 TTCCTGTCCATGAGCATGGAAGG + Intronic
1016057682 6:139595629-139595651 CTCCTGTGCATGAGCTGCAAGGG - Intergenic
1018994842 6:168702867-168702889 CTCCTGAACATGAGGACAAAAGG + Intergenic
1019243424 6:170689699-170689721 CTCCTGTTCATGTTGATACACGG + Intergenic
1020636495 7:10701773-10701795 CTCATGTTCTTATGCATAAATGG + Intergenic
1021345370 7:19520910-19520932 TGCCTGGACATGAGCATAAATGG + Intergenic
1022014153 7:26334610-26334632 ATCAAGTTCATGACCATAAATGG + Intronic
1022440028 7:30425702-30425724 CTCCTTTTCAACAGCCTAAATGG - Exonic
1028011160 7:85646769-85646791 CTCCTATTCATGAAGATAGACGG - Intergenic
1028275319 7:88848900-88848922 CTCCTGTTCAGGAACTTACAAGG - Intronic
1031291359 7:119940295-119940317 CTCCTGTTCTTGAGATTAGAGGG + Intergenic
1031733549 7:125328403-125328425 CTCCTTTTAATGAGCCAAAATGG - Intergenic
1034380049 7:150683958-150683980 CTTCTGAACATGAGCATACATGG - Intergenic
1035862333 8:3042580-3042602 ACCCTGTGGATGAGCATAAAAGG + Intronic
1036280337 8:7394822-7394844 TTCTTGTTAATGTGCATAAATGG - Intergenic
1036341189 8:7917064-7917086 TTCTTGTTAATGTGCATAAATGG + Intergenic
1039662544 8:39482884-39482906 CTCTTGCTCATGAACAAAAAGGG - Intergenic
1042670936 8:71262643-71262665 TTCTTGTTCATGAATATAAAAGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1052724303 9:32211259-32211281 TTCCTGCTCATGATAATAAAGGG + Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1056511385 9:87309410-87309432 GGCCTGTTCATGAGCATATCTGG - Intergenic
1059174256 9:112154919-112154941 CTCCTCTTAATGGGCAGAAAGGG - Intronic
1059453214 9:114383685-114383707 CAAGTGTTCATGAGGATAAAGGG - Intronic
1061757034 9:132822610-132822632 CTTGTGTTCAGGAGGATAAAGGG - Intronic
1203603613 Un_KI270748v1:38922-38944 CTCCTGTTCATGTTGATACACGG + Intergenic
1188713289 X:33428948-33428970 GTTATGTTCATGAGCATAAGGGG + Intergenic
1189010104 X:37038479-37038501 CTCCAGCTCATCAACATAAAGGG - Intergenic
1189038480 X:37517251-37517273 CTCCAGCTCATCAACATAAAGGG + Intronic
1192822289 X:74657896-74657918 CTCTTGTTCAAGACCATCAAAGG - Intergenic
1193622554 X:83773810-83773832 TTCTTGTTCATAAGCATACATGG + Intergenic
1202385677 Y:24323965-24323987 CTCCTGTTCATGTTGATACACGG + Intergenic
1202485109 Y:25346163-25346185 CTCCTGTTCATGTTGATACACGG - Intergenic