ID: 1157127813

View in Genome Browser
Species Human (GRCh38)
Location 18:44973788-44973810
Sequence GTGGAGAGGCAGACAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1244
Summary {0: 1, 1: 0, 2: 10, 3: 135, 4: 1098}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157127804_1157127813 14 Left 1157127804 18:44973751-44973773 CCTCATGGGGCATGATGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG 0: 1
1: 0
2: 10
3: 135
4: 1098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157127813 Original CRISPR GTGGAGAGGCAGACAGAGGA GGG Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900270647 1:1785746-1785768 GTGGGGAGGGAGAGAGAGGGAGG - Exonic
900471146 1:2855576-2855598 GTGGAGGGGGAGGCGGAGGAGGG - Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900569579 1:3351704-3351726 AGGGAGGGGGAGACAGAGGAAGG - Intronic
900614406 1:3558256-3558278 GTGGAGTGGGAGAGAGAGGAGGG - Intronic
900697414 1:4020946-4020968 GGGGCGAGGGAGGCAGAGGATGG + Intergenic
900798279 1:4722716-4722738 GTGGAGATGCAGCCAGAGACTGG - Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900830142 1:4959937-4959959 GGGGAGGGGAGGACAGAGGAAGG + Intergenic
900887957 1:5428858-5428880 GGAGGGAGGGAGACAGAGGAAGG + Intergenic
900906015 1:5558207-5558229 GTGGAGAGTCATGAAGAGGAGGG + Intergenic
901188481 1:7389781-7389803 GTGGTGAGGCCGAGGGAGGAGGG + Intronic
901231088 1:7642075-7642097 GTGGAGAGGCTGAGAGCTGAGGG - Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901506141 1:9687367-9687389 TTGGACGGGCAGACAGAGGCTGG - Intronic
901651158 1:10743900-10743922 GGGGGGAGGCAGGCAGAAGAGGG + Intronic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
901813292 1:11779712-11779734 GGGGAGAGGAAGAGAAAGGAGGG + Intronic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903054270 1:20624524-20624546 GTGGAGAGGCCCACATAGCAAGG - Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
904062937 1:27725672-27725694 GTGGAGAGGCGGAGCGAGGGCGG + Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904455481 1:30645471-30645493 GTGGAAAGGGAGAGAGAGGAAGG - Intergenic
904807262 1:33140806-33140828 TTGGAGAGGACAACAGAGGAAGG + Intergenic
904948216 1:34214738-34214760 GTGGGTAGGCAGCCCGAGGAAGG + Intronic
905122222 1:35690967-35690989 GGGGAGGGGGAGACAGAGGCAGG + Intergenic
905240270 1:36576691-36576713 GGGGAAAGGGAGAGAGAGGAGGG - Intergenic
905294145 1:36943428-36943450 GTGGAAATGGAGTCAGAGGAAGG - Intronic
905857037 1:41321024-41321046 ATGGGAAGGCGGACAGAGGAGGG - Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906532407 1:46531366-46531388 GTGGAGATGGCGCCAGAGGAAGG + Intergenic
906539384 1:46573404-46573426 GTGCAGGGGCAGACACAGGCAGG + Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907145134 1:52224348-52224370 GTGGAGGGGTAGGCAGGGGAAGG + Intronic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907315573 1:53568717-53568739 GTGGAGCAGGAGACAGAGAAGGG - Intronic
907474360 1:54695646-54695668 GTGGAGAGACAGGGAGGGGAGGG - Intronic
907594058 1:55703641-55703663 GAGGAGTGGAAGAGAGAGGAAGG + Intergenic
907705530 1:56829158-56829180 GAGGAGAAGGAGACACAGGAAGG - Intergenic
907765935 1:57410500-57410522 TTGGAAAGGCAGGCAGAGGCAGG + Intronic
907969135 1:59363690-59363712 GTGGAGATGCTGACAGGTGAAGG + Intronic
908107993 1:60865625-60865647 GCAGAGTGGCAGAGAGAGGATGG - Intronic
908916196 1:69129454-69129476 GTTTAGAGGCAGACAGAGGCTGG + Intergenic
908922898 1:69217489-69217511 GAGGGGAGGCTAACAGAGGAGGG + Intergenic
909163383 1:72183426-72183448 GTGGAAGGAGAGACAGAGGAAGG - Intronic
909273495 1:73654701-73654723 GAGGAGAGGGAGAGAGAGCAGGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910474824 1:87595615-87595637 GGGGAGAGGAAAAAAGAGGAAGG - Intergenic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
911191627 1:94954535-94954557 GTGCAGAGGCAGCCATAGAAAGG - Intergenic
911401370 1:97379257-97379279 GGGGAGAGGCAGGCAGGGCAGGG + Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
912664938 1:111570481-111570503 GTGGGGGAGCAGGCAGAGGAGGG + Intronic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913571019 1:120120150-120120172 GTGGAGAGGAAGGCAGAGATTGG - Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
914053727 1:144152748-144152770 GCGGAGAGGCGGACAGTGGCCGG + Intergenic
914203289 1:145505452-145505474 GTGGAAAAGAACACAGAGGAAGG + Intergenic
914237218 1:145823375-145823397 GTGGAAAAGAACACAGAGGAAGG + Intronic
914291829 1:146281128-146281150 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
914357471 1:146899085-146899107 GTGGTCAGGAAGGCAGAGGACGG + Intergenic
914482411 1:148078606-148078628 GTGGAAAAGAACACAGAGGAAGG + Intergenic
914552873 1:148731911-148731933 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915064904 1:153216967-153216989 GTGAAGGGGAAGAGAGAGGAAGG - Intergenic
915367180 1:155323034-155323056 GCGGAGGGGCAGTCCGAGGAGGG + Exonic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
915558911 1:156675351-156675373 GGCGAGAGGCAGTCAGTGGAGGG + Intronic
915740710 1:158116435-158116457 GCAGAGAGGGAGAGAGAGGAGGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916428932 1:164709113-164709135 GTGACGTGGCAGACACAGGAAGG + Intronic
916452440 1:164933959-164933981 GAGGAGAGGCAGAGAGGAGAAGG - Intergenic
916478818 1:165196474-165196496 GAGGCAAGGCAGATAGAGGATGG - Intergenic
916817271 1:168366221-168366243 GTGGAGTGGCCGGCAGGGGAAGG + Intergenic
916889530 1:169102930-169102952 GGGGAGGGGCAGAGAGGGGAAGG + Intergenic
917304060 1:173608892-173608914 GGGGAGAGGAAGGGAGAGGAAGG + Intergenic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917600713 1:176571037-176571059 TTGGAGGGGCACACAGATGATGG - Intronic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918648313 1:186927971-186927993 GTCGAAAGGCAGGCAGTGGAGGG + Intronic
919196568 1:194294598-194294620 GGAGAGAGGCAGAGAAAGGAGGG + Intergenic
919468323 1:197948829-197948851 TAGGTGAGGCAGACAGAGGCTGG + Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
919846969 1:201648553-201648575 GAGGAGGGGGAGAGAGAGGACGG - Exonic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920256115 1:204655628-204655650 GTAGAGAGGAAGAGAAAGGAAGG - Intronic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921568619 1:216751548-216751570 GTGGAGGGGCAGGCAGTGAAAGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
922936355 1:229426014-229426036 GTGGAGACGGAGGCAGAGGTTGG + Intergenic
922988134 1:229882633-229882655 GTGGAGAGCATGCCAGAGGAGGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063036123 10:2288536-2288558 GTGGAGAGGGAGGGAGAGGTCGG + Intergenic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063422182 10:5921756-5921778 CTGGAAAGGCAGACACAAGAAGG + Intronic
1063686519 10:8241974-8241996 ATGGAGAGCCAGACAGTGCATGG - Intergenic
1063866798 10:10373883-10373905 GTGGAGAGGAGGGCAGAGGCCGG + Intergenic
1063876484 10:10484202-10484224 GGAGAGAGACAGAGAGAGGAGGG - Intergenic
1063884363 10:10562711-10562733 GAGGAAGGGAAGACAGAGGAGGG - Intergenic
1063967640 10:11359361-11359383 GTGGGCAGGGAGCCAGAGGAGGG - Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064557986 10:16566645-16566667 GGGGAGAGGCAGAGAGAGAGAGG + Intergenic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1065706574 10:28476342-28476364 GGTGAGAGGCAGGCAGTGGAGGG + Intergenic
1065945910 10:30605450-30605472 GGGGAGGGGCAGAGAGTGGAGGG - Intergenic
1066491705 10:35900853-35900875 GTGGCCAGGCAGCCACAGGAAGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067083385 10:43225876-43225898 GGGGAGGGGGAGAGAGAGGAGGG + Intronic
1067274254 10:44820201-44820223 GTGGAGAGGGTGATAGAGAAGGG - Intergenic
1067300663 10:45005904-45005926 GTGGAGAGGAGCACAGATGAGGG + Intergenic
1067461510 10:46461790-46461812 ATGCAGAGGCAGCCAGAGCACGG + Exonic
1067625684 10:47922811-47922833 ATGCAGAGGCAGCCAGAGCACGG - Intergenic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068188630 10:53619976-53619998 ATGCCTAGGCAGACAGAGGAGGG - Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068716477 10:60194441-60194463 TTATAGAGACAGACAGAGGATGG - Intronic
1069114890 10:64492632-64492654 GGTCAGAGGCAGGCAGAGGAAGG - Intergenic
1069440933 10:68427415-68427437 TTTGGGAGGCAGACAGAGGTGGG + Intronic
1069620381 10:69833870-69833892 TTGGGGAGGCAGACCGTGGAGGG + Intronic
1069801715 10:71085870-71085892 CTGGCAAGGTAGACAGAGGAGGG - Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070586049 10:77767115-77767137 TTGGAGAGGGATACAGTGGATGG - Intergenic
1070806290 10:79272962-79272984 CTGGAGAGGATGACAGGGGATGG + Intronic
1070809455 10:79290336-79290358 GAGGAGTGGAAGAGAGAGGAAGG - Intronic
1070813975 10:79311931-79311953 GGGCAGAGGCTGACAGAGCAGGG - Intronic
1070944796 10:80381000-80381022 GAGGAGAGGGAGAGAGATGAAGG + Intergenic
1071376078 10:85005614-85005636 GTAGAGAGACAGACAATGGAAGG + Intergenic
1071465142 10:85932832-85932854 GTGCAGGGGCTGACAGAAGAGGG + Intronic
1072255548 10:93617043-93617065 GAGGAAAGGAAGAGAGAGGAAGG - Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073303434 10:102484879-102484901 GCGGAGAGGCCAACAGAGCATGG + Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074308283 10:112299032-112299054 GTGCAGAGCCAGGGAGAGGAGGG + Intronic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074490491 10:113935299-113935321 GTGTAGAGGGAGACAGAAAATGG - Intergenic
1075001562 10:118802495-118802517 GTGGGGAGGAGGACAGAGGGAGG + Intergenic
1075139246 10:119816730-119816752 CTGGAGAGCCAGGCAGCGGAAGG + Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075280478 10:121134284-121134306 GTGGACAGAGAGAGAGAGGAAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076495178 10:130892605-130892627 GAGGAGAGGGAGGAAGAGGAGGG - Intergenic
1076563911 10:131385663-131385685 GTGGAGAGTAAGGCAGAGGGAGG + Intergenic
1076563969 10:131385927-131385949 GTGGAGAGTAAGGCAGAGGGAGG + Intergenic
1076660756 10:132054611-132054633 GTCAAGAGTCAGACAGAGGCAGG + Intergenic
1077017457 11:403310-403332 GTTGAGGGGGGGACAGAGGAGGG + Intronic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077423007 11:2461730-2461752 GTGGACAGATAGGCAGAGGAAGG + Intronic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1077520352 11:3029687-3029709 GTGCAGAGGCAAAAAGAGGTGGG + Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077783087 11:5353479-5353501 GTGGGGAGGAAGGGAGAGGATGG + Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078306993 11:10199215-10199237 GAGGAGAGGGAGAGAGATGATGG + Intronic
1078340755 11:10496648-10496670 TGGGAGAGGAGGACAGAGGAGGG + Intronic
1078925808 11:15873923-15873945 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1078938884 11:15977970-15977992 ATGGAAAGGCAGGCAGAGAATGG - Intronic
1079411661 11:20193333-20193355 ATGGAGAGGCAGTCACAGTATGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080147587 11:29005810-29005832 GTGGAGGGGAAGAGACAGGAAGG - Intergenic
1080289277 11:30652728-30652750 GGGAAGAGGCTGACAGTGGATGG + Intergenic
1080352500 11:31401494-31401516 TGGGAGAGGTAGGCAGAGGAAGG - Intronic
1080650737 11:34220917-34220939 GTGAAGACGTAGACAGAGAATGG - Intronic
1080852090 11:36078749-36078771 ATGGAGAGGCAGGCAGAGAGGGG - Intronic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081342021 11:41939932-41939954 TTGGAGAGAGAGACAGAGCAGGG + Intergenic
1081564526 11:44249498-44249520 TGGGAGTGGCTGACAGAGGAGGG + Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083514790 11:63246810-63246832 GTGCAGTTGGAGACAGAGGAGGG - Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083607959 11:63990186-63990208 GTGGAGAGGCAGGCAGCAGTGGG + Intronic
1084145018 11:67260672-67260694 GTGGAGTGGGAGGCAGAGGCTGG - Intergenic
1084601760 11:70149931-70149953 GTGGCGAGGCAGGCAGGGGGTGG - Intronic
1084683084 11:70678480-70678502 GTCGAGAGGCAGGGAGAGGCAGG - Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084860026 11:72012185-72012207 GTGGAGAGGCCGACCTGGGATGG + Intronic
1084936198 11:72588034-72588056 GGGGAGAAGTAGACAGATGAGGG - Intronic
1084963857 11:72733234-72733256 GTGTAGGGGCAGACTGTGGAAGG + Intronic
1085012097 11:73148274-73148296 GTGGTGCCGCAGACAGGGGAAGG - Intergenic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1085454140 11:76656263-76656285 GGGGAGAGGCAGTCAGGGAAGGG + Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085633279 11:78137648-78137670 GAGGAGAGGGAGAGAGATGATGG + Intronic
1085643416 11:78207628-78207650 GTGTAGGGGCAGTCAGAGGGGGG + Intronic
1085658867 11:78343414-78343436 GAGGAGAGGGAGACAGAAGGAGG + Intronic
1085659155 11:78346953-78346975 GTGGTGAGGCAGAGAAAGGGAGG + Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086423832 11:86664702-86664724 GTGGAGATGCTGACAGATGCTGG + Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087023067 11:93622474-93622496 GTGGAGAGGCAGATACATGGAGG + Intergenic
1087564639 11:99838731-99838753 GTGGAGAGGCCGACATGGTAAGG - Intronic
1087608100 11:100401738-100401760 GGAGAGAGGGAGAGAGAGGAGGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1088042773 11:105407746-105407768 GTGTAGAGGAAAACAGAGAATGG + Intergenic
1088260011 11:107935025-107935047 ATGGAGAGGCAGGCAAAGGCCGG - Intronic
1088822598 11:113469333-113469355 GTGAAGAGGGAGACAGCAGATGG - Intronic
1089141601 11:116289128-116289150 GTGGTGTGGCAGAGAGGGGAGGG + Intergenic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089562529 11:119351484-119351506 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
1089655612 11:119944613-119944635 GGGGAGAGGAGGAGAGAGGAAGG + Intergenic
1089784935 11:120901098-120901120 GGGGACAGGCAGACAAAGAAGGG - Intronic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090224683 11:125063057-125063079 GTGGTGAGGCAGAAAGTGCAGGG + Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090826488 11:130390724-130390746 GTGGATATGCAGGCAGGGGAAGG + Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091032839 11:132206557-132206579 GTGGAGAGCAAGACACAGGCAGG + Intronic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091306267 11:134538193-134538215 TGGGAGAGGCAGGCAGCGGATGG + Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091405071 12:203866-203888 GCGGAGAGGCCGGCAGAGGGCGG + Intronic
1091448807 12:560122-560144 GAGAAGGGGCAGAGAGAGGATGG + Intronic
1091567985 12:1662204-1662226 GGGGAGAGGAAGACAGCGGTGGG - Intergenic
1091702765 12:2674689-2674711 GAGGAGAGGCAGGCAGAGGGGGG - Intronic
1091849592 12:3684443-3684465 GTGGAGGGGAAGGCAGGGGAGGG + Intronic
1092141145 12:6184330-6184352 GTGGCTTTGCAGACAGAGGAGGG - Intergenic
1092234198 12:6795905-6795927 GTGGAGAGCCACAGACAGGATGG + Intronic
1092252178 12:6905697-6905719 GACGAGAAGGAGACAGAGGAGGG + Exonic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1092284921 12:7123141-7123163 GTGGAGAGGAGGCCAGAGGCTGG + Intergenic
1092532976 12:9360502-9360524 GTGGAGTGGCAGCCAGGGAATGG - Intergenic
1093934764 12:24988783-24988805 GTGTGAAGGCAGACAGAGAAGGG - Intergenic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1094651628 12:32384166-32384188 GGGGAGAGGCAGATAGAACATGG + Intergenic
1095396350 12:41766481-41766503 GAGGAGAGGAAGACACAGGAAGG - Intergenic
1096098133 12:48951081-48951103 GTAGAAAGGCAGACATAGGCCGG - Intronic
1096331235 12:50714834-50714856 CTTCAGAGGCTGACAGAGGATGG + Intronic
1096455331 12:51780331-51780353 GGGGAGAGGCTGACAGGAGAGGG - Intronic
1096492605 12:52020955-52020977 GTGGAGAGGGGCACAGAGCAGGG + Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1096732472 12:53625827-53625849 GTGGAATGGGAGAAAGAGGAGGG - Intronic
1096741615 12:53697577-53697599 GTGAAGAGCCAGAGAAAGGAAGG - Intergenic
1096777756 12:53974323-53974345 GTGGAGGGGGAGAAAGGGGAGGG + Intronic
1097270622 12:57771942-57771964 GGGCAGAGGGAGAGAGAGGAGGG - Intronic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1099891889 12:88599271-88599293 GTGATGAGGCAGCAAGAGGATGG - Intergenic
1101583603 12:106065905-106065927 GTGGACAGGGAGAAAGATGATGG - Exonic
1101724270 12:107376145-107376167 GTGGTGAGGGAGGGAGAGGAGGG - Intronic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1101828154 12:108236854-108236876 GGGGAGAGGCAGGGAGAGGGGGG - Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102625564 12:114232917-114232939 GAGGAGAGACAGACCAAGGAAGG - Intergenic
1102689537 12:114749564-114749586 GTGCTCTGGCAGACAGAGGATGG + Intergenic
1102840416 12:116113858-116113880 GGGGAGAGGGAGACAGAAGGGGG + Intronic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1102923885 12:116812335-116812357 GCAGAGATGCAGGCAGAGGACGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103501675 12:121407903-121407925 GTGGAGAGGGGGACAAGGGATGG - Intronic
1103744271 12:123111517-123111539 GTGAACGGCCAGACAGAGGAGGG + Intronic
1103854030 12:123952380-123952402 CTAGAGAGGCAGGCAGAGCAAGG + Intronic
1103941089 12:124501582-124501604 GTGGAGATAGAGGCAGAGGATGG - Intronic
1103948174 12:124538468-124538490 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1104004314 12:124881471-124881493 GCGGAGAGGGAGGCAGAGGAGGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104572285 12:129935639-129935661 GAGGAGAGGGAGACAGGGAAGGG - Intergenic
1104609899 12:130219481-130219503 GTGGAGATGCAGGCAGGGGCTGG + Intergenic
1104995340 12:132650750-132650772 GTGTGGGGGCAGACAGAAGAGGG - Intronic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105426193 13:20297041-20297063 GAGGACAGGGAGACAGAGGGCGG - Intergenic
1105635629 13:22212731-22212753 GTGGAGGGGAGGACAGAGGCAGG + Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1106763839 13:32894065-32894087 GGACAGAGGCAGAGAGAGGAAGG - Intergenic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107333361 13:39326162-39326184 GTGGAGAGGATGTCATAGGATGG + Intergenic
1107821863 13:44293214-44293236 GTGGAAAGAGAGGCAGAGGAAGG + Intergenic
1108077364 13:46695195-46695217 ATGGAGAGGCACACAGGGCAGGG - Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108602907 13:52010212-52010234 GTGGACAGACAGAGAGAGGCTGG - Intronic
1108909259 13:55522518-55522540 TAGGAGAGGGAGACAGAAGAGGG + Intergenic
1108970361 13:56367974-56367996 CTGAAGAGGCTGACAGTGGAAGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109828272 13:67752692-67752714 GGGGAAAGGCACACAGAGCAAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110308052 13:74013345-74013367 GTGGCTAGCCAGACAGAGTAAGG + Intronic
1110470474 13:75854419-75854441 GATGACAGGAAGACAGAGGAGGG + Intronic
1110706073 13:78602769-78602791 GTGGAGAGGGGGACAGAAGTAGG + Intronic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112635445 13:101212650-101212672 GTGGTGTGGCAGACTGAGGGAGG + Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113360552 13:109627159-109627181 GTGAAGAGGGAGAGAGATGATGG - Intergenic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113670480 13:112172281-112172303 GTGAAGATGCAGGCAGAGGTCGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114534026 14:23411957-23411979 GAGGGGAGGCAGACAGATGAGGG - Intergenic
1114558727 14:23576841-23576863 GAGGACAGGCAGACAGGGAAGGG + Intronic
1114639066 14:24206944-24206966 GTAGGGAGAGAGACAGAGGATGG - Intronic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115211025 14:30967248-30967270 GAAGAGAGGCAGAGAGAGGGGGG + Intronic
1115631531 14:35250651-35250673 GTAGAGAGGTAGATTGAGGAAGG + Intronic
1116232442 14:42234867-42234889 GATGGGGGGCAGACAGAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116499469 14:45602678-45602700 GAGGAGAGGGAGACAGATGGGGG + Intergenic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1118318011 14:64737395-64737417 GGGGACTGGCTGACAGAGGAGGG + Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119659565 14:76440584-76440606 GTTGAGAGAGAGAGAGAGGAAGG - Intronic
1119755154 14:77112396-77112418 TTTTAGAGTCAGACAGAGGATGG + Intronic
1120030096 14:79631447-79631469 GTGGAGAGACAGGCAGAGGTGGG + Intronic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120404165 14:84073296-84073318 GTGGAGAGGCAGAAAGACAAGGG + Intergenic
1120625963 14:86827016-86827038 GGGAAGAGGCAGGAAGAGGAAGG + Intergenic
1120835511 14:89035408-89035430 GAGGAGAGGCCCACAGAGCAGGG - Intergenic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121293258 14:92794645-92794667 GGAGAAAGGAAGACAGAGGAGGG - Intronic
1121294916 14:92812334-92812356 GCAGAGAGGCACACACAGGAAGG - Intronic
1121441558 14:93953012-93953034 GGGGAGGGGCACCCAGAGGAGGG - Intronic
1121525501 14:94616351-94616373 GAGGAGAGGTCAACAGAGGAAGG - Intronic
1121637703 14:95465085-95465107 GAGGAAATGCAGACAGAGAATGG + Intronic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122503978 14:102219905-102219927 GTGGAGAGTGGGACAGTGGAGGG + Intronic
1122611724 14:102988581-102988603 GTGCAGAGGCAGAGAGAAAATGG + Intronic
1122847129 14:104506163-104506185 GTGGAAAGGCTGACAGTGGCAGG - Intronic
1122907929 14:104810835-104810857 GTCGAGAGGCAGGCAGGAGAGGG - Intergenic
1122958302 14:105083041-105083063 GTGGAGGGGTGGAGAGAGGAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123450865 15:20358161-20358183 GAGGAGAGGAAGGGAGAGGAAGG - Intergenic
1123815187 15:23971085-23971107 GTGGAGATGCAGAGAGTGAAAGG + Intergenic
1124051021 15:26197686-26197708 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1124051032 15:26197737-26197759 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1124103795 15:26718884-26718906 GGGGAGAGGCAGGCTGAAGAGGG - Intronic
1124355315 15:28991170-28991192 GTGCTGAGACAGGCAGAGGAGGG - Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124456192 15:29844964-29844986 GTGGACAGTAAGACAGAGTATGG + Intronic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1124969122 15:34467675-34467697 GTGTAGATGGAGACAGAGGTTGG + Intergenic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1127160519 15:56179743-56179765 GTGTTGAGACAGAGAGAGGAGGG - Intronic
1127381956 15:58438229-58438251 GGAGAGAGGCAGAAAGAGGCTGG + Intronic
1127385274 15:58461883-58461905 GTGGAGGGGTGGACAGAGTAAGG - Intronic
1127698475 15:61474216-61474238 GTGGGGAGGAAGGCAGAGCAAGG + Intergenic
1127724877 15:61739836-61739858 GAGGAGAGGGAGAGAGATGAGGG + Intergenic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1127933136 15:63610865-63610887 GTGGGGATGGAGACAGAGGGAGG + Intronic
1127967915 15:63937560-63937582 GTGGGGAGGGAGCCAGAGGAGGG - Intronic
1128781217 15:70359923-70359945 GTGGAGAGGCAGACCAGGAAGGG - Intergenic
1129059719 15:72851104-72851126 GTGTAGACGCTGACAGAGTAGGG + Intergenic
1129191818 15:73941913-73941935 GTGGAGGGGCAGGAACAGGACGG + Intronic
1129681462 15:77660722-77660744 GTGGACAGGCAGAGAGTGGAGGG + Intronic
1129973464 15:79801112-79801134 GGGGAGAGAGAGAGAGAGGATGG - Intergenic
1130016755 15:80193331-80193353 GTGGAGGTGCAGGCAGAGGTTGG + Intergenic
1130515912 15:84625655-84625677 ATGGAGAGGCAGGCATAGGGAGG - Intronic
1130887844 15:88108971-88108993 GTGGATGGGCAGAGAGAGGGAGG - Intronic
1130939460 15:88495614-88495636 GTGCAGAGGAAGACGGTGGAGGG - Intergenic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131551225 15:93358713-93358735 GGGGCGAGGCAGATGGAGGAGGG + Intergenic
1131671270 15:94621955-94621977 GAGGCAAGGCAGAGAGAGGAGGG + Intergenic
1131759144 15:95600967-95600989 GGGAAGAGGAAGACAAAGGAGGG + Intergenic
1132144980 15:99424351-99424373 GTGGAGGGGGAGGCAGGGGAGGG + Intergenic
1132237449 15:100232762-100232784 GTGAGGAGGCAGTGAGAGGAGGG - Intronic
1132721368 16:1317822-1317844 GTGGAGAGGAAGACCCGGGATGG + Intronic
1132822859 16:1885394-1885416 GAGGAGGGGTAGGCAGAGGAAGG + Intergenic
1133107879 16:3525522-3525544 GGGGAGGGACAGACAGAGGGAGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133250389 16:4476696-4476718 GTGGAGGGGCTGTCAGGGGAGGG + Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133857371 16:9562196-9562218 GTGGACAGACACACAGAGCAGGG + Intergenic
1134039898 16:11060388-11060410 GGGGTGGGGCAGACAGAAGAGGG - Intronic
1134096832 16:11423938-11423960 CTGGAGAGGAAGGCAGAGGGTGG - Intronic
1134122768 16:11596614-11596636 GGGGAGAGGAGGAGAGAGGAGGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134599019 16:15518826-15518848 GGGGAGAGGCGGACAGGGGAAGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134802854 16:17101322-17101344 GTAGAGAGCCAGACAGGTGAAGG - Intergenic
1135236694 16:20763461-20763483 GTGCAGAGTGAGGCAGAGGAAGG + Intronic
1135337633 16:21616975-21616997 GTGGAAAGGATGACAGGGGAAGG - Intronic
1135465404 16:22680553-22680575 GTGGGGAGGGAGGCAGAGGATGG - Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135892014 16:26365814-26365836 GTGAGGAGGCAGGCAGAGGCAGG + Intergenic
1135920576 16:26645535-26645557 GGGGAGATGCAGACAGAGCTAGG + Intergenic
1136004354 16:27318467-27318489 GTGGAGGGACTCACAGAGGACGG + Intronic
1136040226 16:27572707-27572729 GGGGAGAGGAAGAGAGAGGAGGG + Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136299582 16:29324949-29324971 GGGGAGGGGCAGAGAGGGGAAGG - Intergenic
1136403519 16:30030788-30030810 GGGGAGAGGCAAAGAGGGGATGG + Exonic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136550541 16:30980266-30980288 GAGGGGAGGCAGACAGAGTGGGG - Intronic
1137992100 16:53168746-53168768 GTGGAGGGGCAGACAGGGTCTGG + Intronic
1138056180 16:53836323-53836345 GTGGGGAAGCAGACACTGGAAGG - Intronic
1138073016 16:54011897-54011919 GAGGAGAGGGAGAGAGATGAAGG - Intronic
1138124850 16:54430306-54430328 GAGGAGAGAAAGACAGAGGGAGG + Intergenic
1138229681 16:55327830-55327852 GAGGAGAGGAAGGCAGAGGGAGG + Exonic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1138539532 16:57679944-57679966 GGGGAGAGGAAGGCAGGGGAGGG - Intronic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1139189649 16:64847309-64847331 GTGGAGGGACAAAGAGAGGAAGG - Intergenic
1139976714 16:70818209-70818231 GTGGTCAGGAAGGCAGAGGACGG - Intronic
1140153769 16:72401139-72401161 GGAGAGAGGCAGAGAGAGAAAGG + Intergenic
1140430537 16:74899071-74899093 TGGGAGAGGAAGACAGAAGAGGG + Intronic
1140901421 16:79371506-79371528 GAGGAAAGGCAGTCAGGGGATGG - Intergenic
1141168683 16:81677514-81677536 GTTGGGAAGCAGTCAGAGGAGGG + Intronic
1141393203 16:83681596-83681618 GTGGAGGGGAAGAAAGAGAAAGG - Intronic
1141455661 16:84140094-84140116 GTGGAGAGGAATTCAGAGGTGGG - Intronic
1141584279 16:85022983-85023005 CTGACTAGGCAGACAGAGGAAGG + Intergenic
1141645721 16:85366411-85366433 GTGGAGAGGGAAACAGACTATGG - Intergenic
1141759954 16:86021691-86021713 TTTGAGAGGCCGACAGAGGCAGG - Intergenic
1141761311 16:86030416-86030438 GTAGAAAGGAAGACAGGGGACGG + Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142199282 16:88753404-88753426 GTGGCAAGGCTGACAGAAGATGG - Intronic
1142251438 16:88993752-88993774 GGGGAGAGGGAGGGAGAGGAGGG - Intergenic
1142596813 17:1033771-1033793 GTGGAGAGACGGACGGAGGTAGG + Intronic
1142928198 17:3259596-3259618 GGGCTGAGGCAGACAGAGGGTGG + Intergenic
1142988455 17:3712448-3712470 GGTGTGAGGCAGGCAGAGGAGGG + Intergenic
1143504372 17:7355731-7355753 GTGGAGGGGTAGAGACAGGAGGG + Intronic
1143614934 17:8044090-8044112 GGGGAGAGAGAGAGAGAGGAAGG + Intronic
1143863694 17:9908949-9908971 GTGGCGGGGGAGACAGAGAATGG + Intergenic
1143965809 17:10755884-10755906 GTAGAGAGGAAGAGAGAGAAAGG - Intergenic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1144093637 17:11880645-11880667 GTGGAGAGGAAAAGAGAGGAAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144697460 17:17314676-17314698 GAGCAGAGGAAGACAGAGGTTGG - Intronic
1144828008 17:18117273-18117295 GGGAAGAGGCAGACAGAGAGGGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1144948096 17:18980088-18980110 GGGGTGATGCAGCCAGAGGAGGG + Intronic
1144950900 17:18992874-18992896 GTGGGGAGGCAGGGAGAGGGCGG - Intronic
1145102168 17:20086382-20086404 GTGAAGAGGCTGGCTGAGGAGGG - Intronic
1146124689 17:30222085-30222107 TTGGAAAGACACACAGAGGAAGG + Intronic
1146217072 17:30985812-30985834 TTTGAGAGGCAGACAGAGATGGG - Intronic
1146287099 17:31581408-31581430 GGTGAGAGCCAGACTGAGGAGGG - Intergenic
1146412705 17:32601365-32601387 GAGGAGAGGAAGAGAGATGAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146926694 17:36750512-36750534 GTGGACAGGAAGCCTGAGGACGG - Intergenic
1146985397 17:37211641-37211663 GTGGAAAGGAAGATAGAGGGAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147395750 17:40141083-40141105 TTGGAGAGGGAGACAGAGATAGG - Intronic
1147465931 17:40610877-40610899 GAGAAGAGGCAGAGAGAGCAGGG + Intergenic
1147535882 17:41323213-41323235 GTGGAGAGGCAAAAAGTTGAGGG - Intergenic
1147936004 17:44011587-44011609 GGAGAGTGGGAGACAGAGGAAGG - Exonic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1148647216 17:49225922-49225944 CTGGACAGGAAGACAGAGTAGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148739774 17:49886197-49886219 GGGGAGAGGCAGGGAGGGGAAGG + Intergenic
1148866303 17:50630563-50630585 GAGGAGAGGAAGAGAGAAGAAGG - Intergenic
1148901899 17:50884788-50884810 GGGGAGAGGTGGAAAGAGGAAGG - Intergenic
1149036669 17:52141928-52141950 GTAGAAAGGCAGCCAGTGGATGG + Intronic
1149253507 17:54797297-54797319 GAGGAGAGGGATACAGAAGATGG + Intergenic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1149656900 17:58314742-58314764 GTGGAGTGGGAGACAAAGGCAGG + Intronic
1150001394 17:61443078-61443100 GGGGAGGGGGAGACAGAGGAGGG + Intergenic
1150221843 17:63500053-63500075 GGGGTTAGGCAGACAGAGGAAGG - Intronic
1150477982 17:65488584-65488606 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150499584 17:65637664-65637686 GAGGGGAGGAACACAGAGGAGGG - Intronic
1150666003 17:67139010-67139032 GTCCAGGGGCATACAGAGGAAGG + Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152024376 17:77799101-77799123 GTGGAGAGCCACACAGGGGAAGG + Intergenic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1153205261 18:2692429-2692451 GTTGAGAGGAAGACAGGAGAAGG - Intronic
1153270639 18:3317866-3317888 GAGGAGAGGGAGAGAGATGAGGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154006688 18:10536219-10536241 GTGGATAGGGAAACAGATGAAGG + Intronic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155254469 18:23982610-23982632 GGGGAGAGCCAGACAGACGCCGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1156076749 18:33288263-33288285 GGGGAGAGGAAGGGAGAGGAGGG - Intronic
1156309603 18:35909757-35909779 GGGGAGAGGAAGGCAGGGGAGGG + Intergenic
1156470804 18:37376274-37376296 GGGGATAGGAAGCCAGAGGAAGG - Intronic
1156521750 18:37727736-37727758 GTGCAGACACAGACAGAAGATGG - Intergenic
1156591621 18:38496109-38496131 GTATAGAGGAAGACAAAGGATGG + Intergenic
1156688830 18:39681843-39681865 GTGGGTGGGCAGGCAGAGGAAGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157762577 18:50275333-50275355 TGGGACAGGCAGACAGAGGGTGG + Intronic
1157980092 18:52369598-52369620 GCAGAGAGGCAGAGAGAGAAAGG - Intronic
1158692875 18:59676980-59677002 GTGGAGAGGAAGACAGGGGCCGG + Intronic
1158848615 18:61471266-61471288 GTTGAAAGGGAGACAGATGAGGG - Intronic
1158898743 18:61940995-61941017 GTGGTGAGAGAGAGAGAGGAAGG + Intergenic
1158992860 18:62887984-62888006 TTGGGGAGGCAAACAAAGGAGGG - Intronic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1159087470 18:63809925-63809947 GGGGAGGGGAAGACAGAAGAAGG + Intergenic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160077660 18:75693513-75693535 GGGGAGGAGCAGACAGAGGGAGG + Intergenic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160411055 18:78675679-78675701 GTGTAGAAACAAACAGAGGAAGG - Intergenic
1160530742 18:79560812-79560834 GTCGGGAGGCGGGCAGAGGACGG + Intergenic
1161207073 19:3046923-3046945 GAGGAGGGGGAGGCAGAGGAGGG - Intronic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161251733 19:3284509-3284531 GTGGAGAGGGAGACGGGGCAGGG + Intronic
1161256505 19:3312898-3312920 GGAGAGAGACAGAGAGAGGAAGG - Intergenic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161684837 19:5697583-5697605 GAAGAGAGGGAGAGAGAGGAGGG + Intronic
1161849803 19:6732424-6732446 GGGGGGAGGCAGGCAGGGGAGGG - Intronic
1161994219 19:7702598-7702620 GAGGAGAGAGAGGCAGAGGAAGG + Intergenic
1162077168 19:8195621-8195643 GAGGAGGGGGAGGCAGAGGATGG - Intronic
1162335168 19:10055696-10055718 ATCGACAGGCAGGCAGAGGATGG + Intergenic
1162470631 19:10870697-10870719 GAGGAGGGGCTGAGAGAGGAGGG + Intergenic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1162604114 19:11694094-11694116 GAGGAGAGGGAGAGAGAGAAGGG - Intergenic
1162877817 19:13633931-13633953 GAAGAGAGAGAGACAGAGGAAGG - Intergenic
1163212957 19:15854945-15854967 ATGGGCAGGCAGACAGAGGCAGG + Intergenic
1163283475 19:16331526-16331548 GGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1163688981 19:18728247-18728269 GTGGAGAGGCAGAGATGGGCCGG - Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1163749199 19:19065197-19065219 GTGGAGACGCTGCCGGAGGAGGG + Intronic
1163805575 19:19394987-19395009 GTGGAGAGGCAGGCCCAGGCCGG + Intronic
1163860255 19:19739054-19739076 CTGGGGATGCAGACAGAGTAGGG - Intergenic
1164533465 19:29065571-29065593 GTGCACAGGCAGGCTGAGGAGGG + Intergenic
1164560301 19:29287386-29287408 GTTGAGAGGCAATCCGAGGATGG - Intergenic
1164721832 19:30438238-30438260 GTGGGGAGGGAGAGAGGGGAGGG - Intronic
1164940153 19:32245980-32246002 GGGGAGAGGGAGAGAGATGAAGG - Intergenic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1165382743 19:35492680-35492702 GTGGAGAGGAAAACATAGGGAGG - Intronic
1165389589 19:35530632-35530654 GTGGAGAGGGATAGAGAAGATGG - Intergenic
1165824096 19:38695804-38695826 CTGGTGAGGCAGACACAGAAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166249198 19:41555075-41555097 GTGGTTAGGCAGACAGGGCAGGG - Intronic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166947073 19:46404016-46404038 CGGGAGAGGAAGCCAGAGGAAGG - Intergenic
1166997618 19:46727315-46727337 GTGCAGATGTAGACAGTGGAGGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167419031 19:49392154-49392176 GGAGAGATGGAGACAGAGGAAGG + Intronic
1167547939 19:50140418-50140440 GTGGAGAGGGAGACGGGAGACGG - Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1167718516 19:51160837-51160859 GAGGAGAGAAAGGCAGAGGAGGG + Intergenic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
1168291504 19:55359750-55359772 GTGGAGAGGCAGGCAGCCGGGGG + Exonic
1168452711 19:56478223-56478245 GAGGAGGGGCGGACAGCGGAAGG + Intergenic
1168524223 19:57075930-57075952 GCTGAGAGGCACTCAGAGGATGG - Intergenic
1168530480 19:57124371-57124393 GTGGGGAGAGAGACAGAGAAAGG - Intronic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925185218 2:1842443-1842465 GTGAAGAGCGAGACAGGGGAAGG - Intronic
925357706 2:3253792-3253814 GTGCTGAGACAGACACAGGAGGG + Intronic
925410034 2:3634739-3634761 GTGGAGAGGGATTCAGAGGAGGG + Intronic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
925683567 2:6448402-6448424 GTGGAGGGGCAGTGAGGGGAGGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
925976195 2:9143677-9143699 GTGGAATGCCAGACAGAAGAGGG - Intergenic
925991892 2:9260870-9260892 GCGGAGAAGCAGATAGAGTAGGG - Intronic
926147185 2:10403953-10403975 GAGGAGAGGCAGCCAGAAGAAGG - Intronic
926401482 2:12501606-12501628 GTGGAGGGGCAGGAAGGGGAAGG - Intergenic
926573304 2:14553382-14553404 GGGGCCAGGCAGCCAGAGGAGGG + Intergenic
926913441 2:17872209-17872231 GGAGAGAGGGAGAGAGAGGAAGG - Intergenic
927019443 2:19001507-19001529 GTAGGGAGGTAGACAGAGCATGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927240556 2:20916606-20916628 ATGGAGAGGCAGAGAGAGATGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927510444 2:23641023-23641045 GAGGATGGGGAGACAGAGGAAGG - Intronic
927524353 2:23723397-23723419 GAGGAGAGGCAAGGAGAGGAGGG + Intergenic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
927882043 2:26695787-26695809 GGGGAGAGGCAGACAGAGTGCGG + Intronic
928199346 2:29237439-29237461 GAGGAGAGGGAGCCAAAGGAAGG - Intronic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
928455271 2:31415030-31415052 GAGAAGGGGAAGACAGAGGAGGG + Intergenic
928948115 2:36790291-36790313 GTAGAGATGCAGGCAGAGGAGGG - Intronic
929055928 2:37875840-37875862 GAGGACAGGCTGGCAGAGGAGGG - Intergenic
929093777 2:38245051-38245073 GTGGACAGGAAGGCAAAGGAAGG + Intergenic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930227151 2:48805456-48805478 GTGGAGAGGTCCACAGAGCAAGG - Intergenic
931084959 2:58819649-58819671 GTGGAGAGGAACACAGTTGAGGG - Intergenic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
931991757 2:67797206-67797228 GGGGAGAGGATGTCAGAGGAGGG - Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932320504 2:70819039-70819061 GAGGAGAGGAAGGGAGAGGAAGG + Intronic
932423164 2:71613110-71613132 GAGGAGAGGAAGACAGAAGTGGG + Intronic
932445760 2:71780068-71780090 GTGGAGAGAGAGAGAGAGAATGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
934474603 2:94586121-94586143 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
934475810 2:94592607-94592629 GGGGAGAGGTAGACAGAGCAGGG + Intronic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
934553168 2:95274492-95274514 GTGGAGAGAGGGACAGAGGCTGG + Exonic
934707996 2:96498101-96498123 GAGGTGCGGCAGAGAGAGGAAGG - Exonic
934772644 2:96917108-96917130 GTGCACACGCAGACAGAGGCTGG + Intronic
935084865 2:99835278-99835300 CAGGAGAGGCAGACAGAGCTAGG - Intronic
935230272 2:101090004-101090026 GGGGAGAGGAAGGAAGAGGAGGG + Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936230039 2:110692561-110692583 GTGGAGAGGCAAGGAGAAGATGG + Intergenic
936480367 2:112879914-112879936 TGCTAGAGGCAGACAGAGGATGG - Intergenic
936524407 2:113233052-113233074 GTGGAGAGGAAGGGAGGGGAAGG - Intronic
937027343 2:118710668-118710690 GTGGACAGGGAGACAGAGTAGGG - Intergenic
937214875 2:120306132-120306154 GTAGAGAGGAAGACAAAGAAAGG + Intergenic
937320343 2:120957002-120957024 GTGAAGGAGCAGCCAGAGGAGGG - Intronic
937341027 2:121090617-121090639 GGGGAGAGGCAGAGAGAAGGGGG + Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938303616 2:130233207-130233229 GTGGAGAGGTAGCCAGAAGCTGG - Intergenic
938380842 2:130835770-130835792 GGGGAGAGGCAGAGACAGGTTGG + Intergenic
938453063 2:131441052-131441074 GTGGAGAGGTAGCCAGAAGCTGG + Intergenic
938894912 2:135740394-135740416 GAGGTGAGGCAGTCAGAAGAAGG - Intergenic
939350628 2:141033222-141033244 GTGGCTAGGCAGAGAGAGCAAGG + Intronic
939703472 2:145422067-145422089 GTGGAGAGCCAGCCATGGGATGG - Intergenic
939783351 2:146476960-146476982 GTGTAAAAGCAGCCAGAGGAAGG + Intergenic
939787682 2:146537424-146537446 GGGGAGAGGAAGAGAGGGGAGGG + Intergenic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
940537204 2:154960340-154960362 GAGGACAGGGAGACAGATGAGGG + Intergenic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941459305 2:165749107-165749129 GAAGAGAGGCAGACAGAACAAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
941861384 2:170284464-170284486 GGGGAGAGGCAGGCAGAGTGAGG + Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942495827 2:176539030-176539052 GTGGGAAGGTAGACAGAGAAAGG - Intergenic
942548004 2:177084450-177084472 GGGGAAAGGGAGACTGAGGAAGG + Intergenic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
942818388 2:180080467-180080489 GGGGAGAGGGAGAGAGAGGAAGG - Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945030968 2:205663386-205663408 ATGGTGAGGCAGACAGTGAAGGG - Intergenic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946283277 2:218682286-218682308 GGGGAGAGAGAGAGAGAGGATGG - Intronic
946352550 2:219164884-219164906 AGGGAGAGGCAGACAGTTGAAGG - Intronic
946540395 2:220677981-220678003 GTGGAGTGGGTGAGAGAGGATGG - Intergenic
946793421 2:223324259-223324281 GTGGGAAGGCAGTCACAGGAAGG - Intergenic
947139148 2:227004857-227004879 GTGGGGAGGCAGGGAGAGAAGGG + Exonic
947359937 2:229336328-229336350 AGGGACAGGCAGACACAGGATGG + Intergenic
947502635 2:230682675-230682697 GTCTAGAGTCAGACAGATGATGG + Intergenic
947774651 2:232697768-232697790 GCGGAGAAGCAAGCAGAGGAAGG - Intronic
947821471 2:233074235-233074257 GTGGTGAGACACACAGAGGATGG + Intronic
947922787 2:233892951-233892973 CTGGAGGGGCAGACAGCTGATGG - Intergenic
948217423 2:236242213-236242235 GTGGCGTGGGGGACAGAGGATGG - Intronic
948349122 2:237323658-237323680 GTGGAGAGGAAGACAGGAGGAGG + Intergenic
948677632 2:239608139-239608161 GAGGAGAGACAGAGAGAGGGAGG - Intergenic
949021127 2:241742057-241742079 GGGGAGATGCAGGCAGAGGGTGG + Intronic
1168842170 20:916516-916538 GAGGTGAGGCAGACAGAGCAAGG - Intergenic
1168871195 20:1130124-1130146 TTGTAGAGACAGACAGTGGATGG + Intronic
1169065261 20:2691623-2691645 GGGGAGAGGCATAGAGAGAAGGG + Intergenic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169669370 20:8078664-8078686 GGGGAGAGGCAGACACAGGAAGG - Intergenic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1169870232 20:10241368-10241390 GGGGAGTGGCAGAAAGAGGGAGG - Intronic
1170314497 20:15028300-15028322 GAGGAAGGGCAGTCAGAGGAGGG + Intronic
1170415444 20:16134076-16134098 GTGGAGAGGGACACAGGGCAAGG - Intergenic
1171134395 20:22683995-22684017 GTGGAGAGGCAGCCAGGGCTTGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171230540 20:23480670-23480692 TTGGAGGGGCAGAGAGATGAGGG + Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172068336 20:32237538-32237560 CTGGAGAGGCAGGCATAGGCAGG + Exonic
1172192131 20:33068521-33068543 GTGGAGAGGCGGGCAGGGGATGG + Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172621267 20:36319984-36320006 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172621285 20:36320038-36320060 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172978928 20:38926656-38926678 GCGGAGAGGCCGGGAGAGGAGGG + Exonic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173486992 20:43448365-43448387 GGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1173627780 20:44486376-44486398 GAAGAGAGGCAAACAGAGGCTGG - Intronic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174140272 20:48408280-48408302 GTGGAGAGCCAGCCAGGGAAAGG - Intergenic
1174153680 20:48503324-48503346 GTGGAGATGCAGACCCAGGCAGG - Intergenic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1175311103 20:58012082-58012104 GAGGAGAGACACACAGAGAAGGG + Intergenic
1175369512 20:58478449-58478471 GTGGAGTCACAGGCAGAGGAAGG - Intronic
1175412182 20:58777617-58777639 GTGGAGAAGCAGACAGCTGTTGG - Intergenic
1175487321 20:59355557-59355579 GGGGAGAGGAAGAGAGGGGAGGG - Intergenic
1175487329 20:59355578-59355600 GGGGAGAGGAAGAGAGGGGAGGG - Intergenic
1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG + Intronic
1175795110 20:61766191-61766213 GTGGCGAGGGAGACTGAGGGTGG - Intronic
1175798957 20:61790125-61790147 GTGGATGGGTGGACAGAGGATGG - Intronic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176287088 21:5023901-5023923 GGGGAGTGGGAGAGAGAGGAAGG + Intronic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176718101 21:10371530-10371552 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1176870087 21:14076947-14076969 GAAAAGAGACAGACAGAGGAAGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178110210 21:29362801-29362823 GTGGAGAGGAAGGCAGAGACTGG + Intronic
1178133293 21:29597656-29597678 GTGAAGAGGAAGCCAGAAGATGG + Intronic
1178250284 21:30997376-30997398 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178526844 21:33337342-33337364 GAGGAGAGGCAGGCAGAAGGAGG + Intronic
1178675961 21:34631841-34631863 GTGAAGATGGAGACAGAGGTTGG - Intergenic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179119441 21:38529272-38529294 GAGGAGAGGCAGGGAGATGAGGG + Intronic
1179236982 21:39556303-39556325 GTGAAGAGGCAAACTGTGGAGGG + Intergenic
1179624730 21:42642510-42642532 GTTTACTGGCAGACAGAGGAGGG - Intergenic
1179870093 21:44239574-44239596 GGGGAGTGGGAGAGAGAGGAAGG - Intronic
1180094753 21:45550848-45550870 GAGGGGAGGAAGGCAGAGGAGGG - Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180118435 21:45727501-45727523 GTCAAGAGGCAGAGAGAGCAAGG + Intronic
1180146981 21:45927270-45927292 GGGGAGAGGGAGGGAGAGGAGGG - Intronic
1180262238 21:46679916-46679938 ATGGTGAGGCAGACACAGAAAGG + Intergenic
1180299329 22:11024440-11024462 GTGGAGAGAGAGAGAGAGAAAGG - Intergenic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180645769 22:17337610-17337632 GAGAAGAGGCAGAGAAAGGATGG - Intergenic
1181381320 22:22507093-22507115 ATGGAGAGGCCCACAGAGCAAGG + Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181439163 22:22926989-22927011 AGGGAGGGGCAGCCAGAGGAAGG - Intergenic
1181440552 22:22933325-22933347 GTGGGGAGGAAGGCAGAGGTGGG - Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181775969 22:25160512-25160534 GAGGAGAGGGAGACAGAGACAGG - Intronic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1181911377 22:26240961-26240983 TGCCAGAGGCAGACAGAGGAGGG + Intronic
1181958539 22:26605882-26605904 GTGGCAGGGCAGAGAGAGGAAGG + Intronic
1182027994 22:27135402-27135424 GGGGAGAGGGAGAAAGAGAAGGG + Intergenic
1182072788 22:27475431-27475453 CAGGAGGGGCAGGCAGAGGAAGG - Intergenic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1182386460 22:29946279-29946301 GAGGAGAGGGAGGCAGATGATGG + Intronic
1182399659 22:30066072-30066094 AGGGAGAGGGAGACAGAGGGAGG - Intergenic
1182546406 22:31079274-31079296 GCAGAGAGGAAGACAGAGGCAGG + Intronic
1182715179 22:32352580-32352602 GTGGAGGTGCAGCCAGGGGAAGG - Intergenic
1182995307 22:34806826-34806848 ATGGAGAGGCAAACAAAGAAAGG + Intergenic
1183102698 22:35593613-35593635 GGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1183269413 22:36851281-36851303 GTGAAGACGCTGACAGAGGCTGG + Intergenic
1183511691 22:38239168-38239190 GTGGAGGGGCAGGCAGATGGGGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183857165 22:40642618-40642640 GTAGGGAGTCAGACCGAGGAAGG - Intergenic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184793677 22:46718383-46718405 GTCGAGAGACAAACAGAGGAGGG + Intronic
1185091644 22:48778869-48778891 GTGGGGAGGCAGGCAGAGCTGGG + Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
1185417194 22:50716681-50716703 GTGGTGAGGCACAGAGGGGAAGG - Intergenic
949873442 3:8608353-8608375 ATTCAGAGGCAGACAGAGGGAGG - Intergenic
950276629 3:11666858-11666880 GTGGAGGGGAGCACAGAGGAGGG - Intronic
950678354 3:14568223-14568245 GGGGAGGGACAGACTGAGGAGGG + Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951881346 3:27483999-27484021 GGGGCGAGGCAGACAAAGGCGGG - Intronic
951909064 3:27730462-27730484 GTGGGGAGGAGGACAAAGGAGGG - Intergenic
952582284 3:34848614-34848636 GTGGGAAGGCAGACAGGGTAGGG - Intergenic
952883734 3:38000637-38000659 GTGGACAGGCAGGCAGAGACAGG + Intronic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
954266220 3:49472172-49472194 GTGGAGTGGCAGGAAGAGGGAGG + Intronic
954368267 3:50157251-50157273 GGGAAGAGGCGGCCAGAGGAAGG - Intronic
954625502 3:52019978-52020000 GTGGAGGGGCAGAGAGAAGCGGG + Intergenic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955496592 3:59540041-59540063 GGAGAGAGACAGAGAGAGGAAGG - Intergenic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956171840 3:66439071-66439093 GAGGAGAGGAAGACAGAGCAGGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956659417 3:71583362-71583384 GGGGAGAGGAAGAGAGGGGAGGG + Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957771360 3:84696355-84696377 GAAGGGAGTCAGACAGAGGAAGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
959260933 3:104078491-104078513 GAGGAGAGGGAGACAGAATAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960194814 3:114752753-114752775 GTTCTGAGGCAGACAGAGTAAGG - Intronic
960236718 3:115291867-115291889 GTGGAGAGTGAAACAGAGGATGG + Intergenic
960242265 3:115358892-115358914 GGGGAGAGGGAGAGAGAGGGGGG + Intergenic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
961460301 3:127045724-127045746 GTAGAGAGGAAGAGAGGGGAAGG + Intergenic
961505126 3:127365555-127365577 GAGCAAAGGCAGACAGAGCAGGG - Intergenic
961516934 3:127443867-127443889 CTGGGGAGTCAGACAGAGGCAGG + Intergenic
962532807 3:136298944-136298966 GGGCAGAGGCAGACAGAGTGAGG - Intronic
962649609 3:137475487-137475509 GAGGAGAGGAAGAGAGAGGGAGG - Intergenic
963009492 3:140755891-140755913 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
963128230 3:141834622-141834644 GAGGAGAGGGAGAGAGAGAAAGG - Intergenic
965881725 3:173395874-173395896 GGGGAGAGGGAGGCAGCGGAGGG + Intergenic
965896723 3:173585746-173585768 GTGGCGAGGCAGGCAGGGCAGGG - Intronic
966304775 3:178518928-178518950 GAGCAGAGGAAGACACAGGATGG - Intronic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967108988 3:186276564-186276586 GTGAAAAGACAGACAGAGAAAGG + Intronic
967356495 3:188577869-188577891 GGGGAGAGGAAGACAGAAGGGGG - Intronic
967512426 3:190327053-190327075 GAGGAGAGAGAGAGAGAGGAAGG + Intronic
967577931 3:191118968-191118990 GATGAGAGACAGAGAGAGGAAGG + Intergenic
968107867 3:196015107-196015129 ATGGTGAGGCAGACACAGAAAGG - Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968623249 4:1614112-1614134 GTGGAGCAGCAGACACTGGAGGG + Intergenic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969197753 4:5576676-5576698 TTGGTCAGGCAGACAGAGAAAGG - Intronic
969511125 4:7618509-7618531 GCGGAGAGGCAGGCAGAGTGCGG - Intronic
969550208 4:7860955-7860977 GGGGAGCAGCAGACAGAGGGCGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969621030 4:8278985-8279007 GAGGAGGGGCGGAGAGAGGAGGG - Intronic
970837315 4:20425878-20425900 AGGGAGAGGCAGGCAGAGAAAGG - Intronic
971070506 4:23086028-23086050 GAGGAGAGGAAGGTAGAGGAGGG + Intergenic
971296711 4:25400355-25400377 GAGGAAAGGCTGAGAGAGGAGGG + Intronic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972873317 4:43327548-43327570 GAGGAAAGGCAGAGAGAGCAAGG - Intergenic
973758700 4:54098743-54098765 GGAGAGGGGAAGACAGAGGATGG + Intronic
974036445 4:56821922-56821944 GGGGCGAGGGAGATAGAGGAAGG + Intergenic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
974838640 4:67278368-67278390 GTGCAGAGGAATACAGAAGAAGG + Intergenic
974967210 4:68775053-68775075 GAGGACAGGCAGACAGAGATGGG + Intergenic
975001618 4:69230394-69230416 GAGGACAGGCAGACAGAGATGGG + Intergenic
975003825 4:69261723-69261745 GAGGACAGGCAGACAGAGATGGG - Intergenic
976628049 4:87207865-87207887 GTGGTGAAGCAGACATCGGAGGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977241877 4:94581303-94581325 GTGGAGCGGCAGCAAGTGGAGGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977902622 4:102439551-102439573 GTGGAGAGGCAGAAAAGGAAGGG + Intergenic
978346755 4:107777998-107778020 GAGGAGAGGAAAAGAGAGGAGGG + Intergenic
978451037 4:108834178-108834200 GGGGAAAGGTGGACAGAGGACGG - Intronic
979350034 4:119632745-119632767 GTGAAGAGGCAGCAAGAGAATGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
980219979 4:129901762-129901784 GGGGAGAGGCAGAGAGAAGGAGG - Intergenic
980309666 4:131109685-131109707 GAGGAGAGGGAGAGAGAGGCTGG + Intergenic
980749743 4:137072704-137072726 GGGGAGAGAGAGAGAGAGGAAGG - Intergenic
980933729 4:139206487-139206509 GGGGAGAGGGAGAGAGAAGATGG - Intergenic
980969091 4:139552613-139552635 GTGGAGGGGAAGACAGGGAAAGG - Intronic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
982089335 4:151866903-151866925 GAGAAGAGGCAGAGAGAAGACGG - Intergenic
982629063 4:157808596-157808618 TTGGGGAGAAAGACAGAGGAGGG + Intergenic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
982754103 4:159198391-159198413 GAAGAGAGGAAGAGAGAGGAAGG - Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984704852 4:182840219-182840241 GGGGTGAGGCATGCAGAGGAAGG - Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
984805137 4:183745260-183745282 GTGGAGGTGAAGACAGAGAATGG - Intergenic
985039264 4:185872715-185872737 GGGGAGAGGGAGAAAGAGGGAGG + Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985412135 4:189696020-189696042 GTGGAGGGACAGACACAGGCGGG - Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985469802 5:33174-33196 ATGGTGAGGCAGACACAGAAGGG - Intergenic
985704594 5:1393047-1393069 CTGGGGAGGGACACAGAGGACGG - Exonic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
985956232 5:3268209-3268231 GGGGAAAGGCAGGCAGAGCAAGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986423746 5:7610025-7610047 GTGGAGATGCAGACAGGGGTGGG + Intronic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986717288 5:10533459-10533481 GTGGAGACGCTGGCAGAGGAGGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987181212 5:15370390-15370412 GTGGAAATGCAGTCAGGGGATGG - Intergenic
987930098 5:24391094-24391116 GTGGAGGGGAATACAGAAGAAGG - Intergenic
988358001 5:30201543-30201565 GTGGAGGGGAATACAGAAGAAGG - Intergenic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989662823 5:43817556-43817578 GTGGAGAGGAAGAGATAGCAAGG - Intergenic
990054796 5:51559573-51559595 GTGGAGTGGCAGACAGAGTAGGG + Intergenic
990339170 5:54805435-54805457 GAGGAGAGAGAGATAGAGGATGG - Intergenic
990356867 5:54976207-54976229 GTGGATAGGTAGATAGATGAAGG - Intergenic
990442501 5:55860924-55860946 GTGAAGAGGCAGCAAAAGGAAGG - Intronic
990457825 5:56005154-56005176 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
990878580 5:60516402-60516424 ATGGAGAGCCAGACAGAGACAGG - Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992437813 5:76772307-76772329 GAGGAGAGGAAAACAGAGAAAGG + Intergenic
995038513 5:107562337-107562359 ATGGAGAGAGAGACAGACGATGG - Intronic
995118227 5:108505964-108505986 GAGGAGAGGAGGAGAGAGGAGGG - Intergenic
995138181 5:108702802-108702824 GTGAGGAGGTAGACAGAGAAGGG - Intergenic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996999828 5:129746347-129746369 GGGTAAAGGCAGACAAAGGATGG + Intergenic
997472806 5:134126107-134126129 GTGGCCAGGCAGGCAGAGGTGGG + Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
998112125 5:139510417-139510439 GTGGGGAGGCAGATATAGGTCGG - Intergenic
998384647 5:141749784-141749806 GTGGTGAGGAGGACAGAGGCTGG + Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999403794 5:151288482-151288504 AGGAAGAGGCAGACAGAGGGAGG + Intronic
999487142 5:152008170-152008192 GGGGAGAGACAGACAGAGGAGGG - Intergenic
999805420 5:155076700-155076722 GAGGAGAGGCAGGCAGAGCCAGG - Intergenic
1000085433 5:157883958-157883980 GTGCAGAGGAATACAGAAGAAGG - Intergenic
1000335833 5:160240731-160240753 GGGGAGAGAGAGAAAGAGGAAGG + Intergenic
1000611333 5:163378371-163378393 GGGGAGAGGCAGACAGAGCTGGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001789942 5:174447481-174447503 GAAGAGAGGAGGACAGAGGAAGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1001960083 5:175874716-175874738 GAGGGGAGGCAGAGAGAGGGAGG + Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002596468 5:180327223-180327245 GTGGAGAGGCGGACAGAGGCCGG - Intronic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1002868686 6:1146900-1146922 GGGGAGAGACAGACAGAGCAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003551306 6:7104494-7104516 GGGGAGAGGTGGAAAGAGGAGGG + Intergenic
1003750533 6:9050111-9050133 TTGGAGGGGCATCCAGAGGAAGG + Intergenic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1003895455 6:10603477-10603499 GTCCAGATGCAGACAGGGGAGGG + Intronic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004394938 6:15239413-15239435 TTGGAGAGGATGACAGAAGAAGG + Intergenic
1004406147 6:15335603-15335625 GTGGACAGGCAGGCAGAGAAAGG - Intronic
1004632627 6:17436561-17436583 TTGGAGAGGAAGAGAGAGGGAGG + Intronic
1005310686 6:24556178-24556200 GGGGAGAGGAGGGCAGAGGAGGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005475883 6:26207359-26207381 GAGGTGAGGCAGACAATGGAAGG + Intergenic
1005565715 6:27091991-27092013 GAGAAGAGACAGACAGAGGTGGG - Intergenic
1005574599 6:27179692-27179714 GCGGAGAGGTAGGCAGGGGAAGG - Intergenic
1005811199 6:29517756-29517778 CTGGATATGCAGACATAGGAAGG - Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006259946 6:32859363-32859385 GGAGAGAGGGAGAGAGAGGATGG - Intronic
1006291573 6:33141735-33141757 GGGGTGAGGCGGACAGCGGATGG + Intergenic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006478265 6:34272167-34272189 GGGAAGAGGCAGACACAGTAAGG + Intergenic
1006781767 6:36637080-36637102 GGGGAGAGGCAGAGAGCAGAAGG + Intergenic
1006919093 6:37615775-37615797 TTGGACAGGCAGACAGGGGCAGG - Intergenic
1007009197 6:38398571-38398593 GTGAGCAGGTAGACAGAGGATGG - Intronic
1007484757 6:42173428-42173450 GTGGAGAGGGAGAGAGCAGAAGG - Exonic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007705866 6:43790916-43790938 GTGGAGAGACAGAGAGAGATAGG + Intergenic
1008122443 6:47633865-47633887 GTGGAGAGGGAGACAGAATCAGG - Intergenic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010719616 6:79268035-79268057 GGGAAGAGGTAGACAGAGGAAGG + Intergenic
1010993569 6:82506964-82506986 GTAGAGAGAGAGAGAGAGGAGGG - Intergenic
1011190086 6:84719366-84719388 GGGGAGAGAGAGAGAGAGGAAGG - Intronic
1011663268 6:89612246-89612268 GGAGAGAGGCAGAGAGAGGGAGG - Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011968526 6:93191745-93191767 GTGGAGAGGAAGGAAGAGAAGGG + Intergenic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013498532 6:110723058-110723080 GTGCACACTCAGACAGAGGAGGG - Intronic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1013657042 6:112256805-112256827 CTGGGCAGGCAGACAGAAGAGGG - Intergenic
1013790401 6:113829850-113829872 GTGGGGAAGCAGGCAGAGAATGG + Intergenic
1013950928 6:115781014-115781036 GTGGATAGGTAGACAGATAAAGG + Intergenic
1014153705 6:118087624-118087646 TTGGAGAGGTAGGCAGAGGAGGG - Intronic
1015699469 6:136019899-136019921 GAGGAGAGGGAGGAAGAGGAAGG + Intronic
1015738998 6:136433386-136433408 GTGTAGATGCTGACAGAAGAAGG - Intronic
1015874522 6:137809291-137809313 GTGGGCTGGCAGAGAGAGGAGGG - Intergenic
1015878234 6:137845585-137845607 GTGGAGTGGAGCACAGAGGAAGG + Intergenic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016616941 6:146061060-146061082 GTGGAGAGGGAGAGAGATGGGGG + Intronic
1017188215 6:151624002-151624024 GGGGAGAAGAAGACAGAGGTAGG - Intergenic
1017193424 6:151676930-151676952 TTGGAGATGGAGACAGAGTATGG + Intronic
1017622639 6:156315023-156315045 TCGGGGAGACAGACAGAGGAGGG + Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018184156 6:161251506-161251528 GTGGAGAGGCCAAGAGAGCAAGG - Intronic
1018342057 6:162861635-162861657 GTGGTGAGGCAGAGGGAGGTGGG - Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1018760760 6:166892386-166892408 GGAGAGAGAGAGACAGAGGAGGG + Intronic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1018812239 6:167306627-167306649 GTGGGGGCGCAGCCAGAGGAAGG + Intronic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019078382 6:169410228-169410250 GTGGACAGGCAGAGAGGGAAGGG - Intergenic
1019110652 6:169709529-169709551 AGGGAGGGGCAGACAGAGGGAGG + Intronic
1019512244 7:1423458-1423480 GGGGAGAGGAAGAGAGAGGGGGG + Intergenic
1019778510 7:2926213-2926235 ATGGAGAGGCCGACATTGGAGGG - Intronic
1019823151 7:3261192-3261214 TTGGAGAGGCAGACAGTATATGG - Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1022012791 7:26323519-26323541 GAGGAGAGGAAGAGAGTGGAAGG + Intronic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022506391 7:30910695-30910717 GAGGAGAGGCAGAGAGCGGGAGG - Intergenic
1022899356 7:34787723-34787745 GAGGAGAGGGAGACAGATGGAGG + Intronic
1022973762 7:35538888-35538910 GTGACCAGGCGGACAGAGGAGGG - Intergenic
1023161073 7:37296332-37296354 GTGGAGAGGGCTACAGAGAAAGG - Intronic
1023297074 7:38726418-38726440 GTGGAGAGGAAGTAATAGGATGG + Intronic
1023821438 7:43982871-43982893 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1025232975 7:57215118-57215140 CTAGAGGGGAAGACAGAGGATGG + Intergenic
1026101460 7:67387885-67387907 GAGGGGAGGGAGACAGAGCAAGG + Intergenic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1026738752 7:72965439-72965461 GGGGAGAGAGAGAGAGAGGAAGG + Intronic
1026837677 7:73649262-73649284 GAGGAGAGGAAGAGAGAGGGGGG - Intergenic
1027104982 7:75399630-75399652 GGGGAGAGAGAGAGAGAGGAAGG - Intronic
1027232562 7:76281411-76281433 GGAGAGAGGCAGACAGGGCACGG - Intronic
1027348712 7:77288506-77288528 GTGTAGGGGTAGACTGAGGAAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028134259 7:87209943-87209965 GGGGACAGAGAGACAGAGGAGGG + Intronic
1028351764 7:89858086-89858108 GTGGAGAGGAAGACAGTGGGGGG - Intergenic
1028472922 7:91224189-91224211 GCGGAGGGACAGGCAGAGGAGGG - Intergenic
1028764126 7:94531277-94531299 GAGGAAATGTAGACAGAGGAAGG + Intronic
1029364157 7:100106628-100106650 GGGCAGAGGCAGGGAGAGGAAGG - Intronic
1029477723 7:100794910-100794932 GAGGAGAGGAAGGGAGAGGAGGG + Intronic
1029571567 7:101373128-101373150 GGGGAGAGGCTGGCAGAGGAAGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029749701 7:102536292-102536314 TGGGAGAGGCAGGCAGGGGATGG - Intergenic
1029767651 7:102635397-102635419 TGGGAGAGGCAGGCAGGGGATGG - Intronic
1030039810 7:105439485-105439507 GTGGACAGGCAGCCCAAGGAGGG - Intergenic
1030302629 7:107989724-107989746 GGGGAGAGGAAGAGAGGGGAAGG + Intronic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1031082442 7:117271847-117271869 GTGGGGAATCAGACAAAGGATGG - Intergenic
1031897234 7:127364639-127364661 GTGGACAGGGAGACAGAAGCTGG + Intronic
1032086805 7:128888760-128888782 GTGGAGCGGCAGGCAGTGGGAGG + Intronic
1032090047 7:128907051-128907073 GGAGAGAGGCAGACAGGTGAGGG + Intronic
1032092997 7:128921086-128921108 GTGGGGAGGGAGGCAGAGAAGGG + Intergenic
1032139424 7:129313538-129313560 GTGGACAGCCAGACAGACAAAGG + Intronic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032683525 7:134209218-134209240 GTAGAGGTTCAGACAGAGGAGGG - Intronic
1033154593 7:138946065-138946087 GGGGAGAGGCAGGCAAAGGGTGG - Intronic
1033283031 7:140019060-140019082 CTGGACAGGCAGGCATAGGAAGG + Intronic
1033439483 7:141365978-141366000 TGGGAGAGGCAGACAAAAGATGG - Intronic
1033447484 7:141435935-141435957 GAGGAGGGGCCTACAGAGGAAGG - Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034055782 7:148033465-148033487 GTGGAGTGGCGGGTAGAGGAAGG - Intronic
1034190188 7:149207781-149207803 TCAGAGAGGCTGACAGAGGAGGG + Intronic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1035169195 7:157008648-157008670 GGGGAGATGCAGGCAGAGCAGGG - Intronic
1035297259 7:157874195-157874217 GTGGAGGGGGAAACAGAGGGAGG - Intronic
1035606155 8:930931-930953 GTGGGGAGGGAGGCAGGGGAAGG + Intergenic
1035965979 8:4192435-4192457 ACGGAGAGCCACACAGAGGAAGG - Intronic
1036089021 8:5644931-5644953 GTGGAAATGCAGACACAGGAAGG - Intergenic
1036547699 8:9788072-9788094 GTGAAGAGGCCGACAGAGGGGGG + Intergenic
1036630906 8:10514357-10514379 GTGGCTAGGCAGACAGTGAAAGG + Intergenic
1036961416 8:13248719-13248741 GTGGAGAGGGAGACATGGGATGG - Intronic
1037012003 8:13855420-13855442 GTGGAAAGGCAGGCATGGGAAGG - Intergenic
1037555386 8:20017412-20017434 GGAGAGAGAAAGACAGAGGAAGG + Intergenic
1037718753 8:21422817-21422839 TTGGACTGGCAGGCAGAGGAGGG - Intergenic
1038535704 8:28351623-28351645 GTGGAAGAGCAGACAGAGGCAGG + Exonic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1040575163 8:48645684-48645706 GAGGAGCAGGAGACAGAGGAAGG - Intergenic
1040620486 8:49086348-49086370 TTGCAGAGGCAGACAGAGAGAGG + Intergenic
1040892410 8:52330938-52330960 ATGGAGAGGCAGACAGACAGAGG + Intronic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041390399 8:57342707-57342729 GTGGAATGCCAGACAGAAGAGGG + Intergenic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1042093646 8:65188024-65188046 GGGGAGAGGAAGACTGAAGAGGG - Intergenic
1042672148 8:71276232-71276254 GTGGACAGGCAGCCAGTTGATGG + Intronic
1042791209 8:72608279-72608301 GCAGAGAGGCAGGCAGAGGCTGG + Intronic
1042857527 8:73283182-73283204 ATGGAGAGGCAGACAGTTCAGGG + Intergenic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043594805 8:81872806-81872828 GTGGGGAGGCTGGCAGAAGATGG - Intergenic
1043602062 8:81952594-81952616 GAGGAGAGGGAGGGAGAGGAGGG - Intergenic
1043938337 8:86168618-86168640 GTGGGGTGGGAGACAGAGGGAGG - Intergenic
1044939095 8:97322214-97322236 CTCCAGAGGCAGACAGAGGTAGG + Intergenic
1045478040 8:102569672-102569694 GAGGAGAGGAAAAGAGAGGAGGG - Intergenic
1045948552 8:107825754-107825776 GAGGAGAGGGAGAAAGATGAGGG + Intergenic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046827924 8:118712070-118712092 GGGGAAAGGCAGCCAGAGAATGG + Intergenic
1046855125 8:119022726-119022748 CTGGGGAGGCAGCCAGTGGAGGG - Intronic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047085020 8:121506530-121506552 GTCAAGAGGCAGAAAGAGAAAGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047263302 8:123281532-123281554 GTGGAGACGCAGGGAGAAGATGG - Intergenic
1047312102 8:123700778-123700800 GTGGAGAGGAAGGGAGAGAAGGG - Intronic
1047422561 8:124719104-124719126 GTGGAGAGGCACACAGACCCTGG + Intronic
1048031115 8:130633426-130633448 GGGGAGAGGGGGAGAGAGGAGGG - Intergenic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048545367 8:135381879-135381901 GTGAAGAGCCAGTGAGAGGAAGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048862340 8:138733131-138733153 GTGGAAATGCAGGCAGGGGAGGG - Intronic
1048864087 8:138746655-138746677 GTGCAGAGCAACACAGAGGATGG - Intronic
1048967699 8:139626307-139626329 GGGGAGAGGTAGACAGAGCAGGG + Intronic
1049014104 8:139907518-139907540 GAGGAGAGGGAGAAAGAGAAAGG + Intronic
1049051583 8:140201132-140201154 GTGGACAGCCAGGCAGAGGCGGG + Intronic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049879586 8:145052691-145052713 GGGCAGAGACAGACAGTGGAAGG - Exonic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1051487072 9:17620558-17620580 TTGGAAGGGCAGACAGAAGAGGG + Intronic
1052001328 9:23285106-23285128 GGAGAGAGGGAGGCAGAGGAAGG + Intergenic
1052310674 9:27065270-27065292 GTGGAAAGGCTCTCAGAGGAAGG - Intergenic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1052854244 9:33397310-33397332 GGGGAGAGGTAGACAGAGCAGGG - Intronic
1052855451 9:33403637-33403659 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1052876939 9:33574557-33574579 CTAGGGATGCAGACAGAGGAGGG - Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053108863 9:35439200-35439222 GAGCAGGGGCAGATAGAGGAAGG - Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053682255 9:40493471-40493493 GGGGAGAGTTAGACAGAGCAGGG - Intergenic
1053683465 9:40499980-40500002 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1053886364 9:42647157-42647179 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1053922806 9:43015089-43015111 GCGGGGAGGGTGACAGAGGAGGG - Intergenic
1053932237 9:43121798-43121820 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1053933444 9:43128295-43128317 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054225384 9:62454606-62454628 GTGGAGGTGCAGCCAGAGCAAGG + Intergenic
1054280250 9:63124948-63124970 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
1054281459 9:63131458-63131480 GGGGAGAGTTAGACAGAGCAGGG + Intergenic
1054295353 9:63328971-63328993 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054296569 9:63335478-63335500 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054393371 9:64633475-64633497 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054394586 9:64639983-64640005 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054428020 9:65138689-65138711 GGGGAGAGGTAGACAGAGCAGGG - Intergenic
1054429235 9:65145182-65145204 GGGGTGAGGCAGGGAGAGGAAGG + Intergenic
1054501149 9:65876353-65876375 GGGGTGAGGCAGGGAGAGGAAGG - Intergenic
1054502358 9:65882855-65882877 GGGGAGAGGTAGACAGAGCAGGG + Intronic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055039525 9:71854282-71854304 GAGGAGAGGGAGAGAGATGAGGG + Intergenic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056264313 9:84881035-84881057 GTGGAGATGCAGCCAGAGAGTGG + Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056760470 9:89411075-89411097 GAGGAGAGGCAGAGAGAGCGGGG + Intronic
1056761369 9:89417786-89417808 GAGGAGAGGCCGAGAGAGCAGGG + Intronic
1056901103 9:90600215-90600237 GTGAGGAGGCTGAGAGAGGAGGG - Intergenic
1057008484 9:91581483-91581505 GTGGAGAGAGAGACAGAGTTTGG - Intronic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057274398 9:93668608-93668630 GTGGAGATGGGGACAGAGGTGGG + Intronic
1057488997 9:95507682-95507704 GGAGAGAGGCGGAGAGAGGAAGG - Intronic
1057495036 9:95553846-95553868 GTGGAGAGGCAGGCAGAGATTGG + Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057896838 9:98916005-98916027 GTGAGGAGCCAGACAGAGAATGG + Intergenic
1057924103 9:99127662-99127684 GTGGCTAGGCAGACAGGGGCAGG - Intronic
1058054087 9:100432273-100432295 GTAGAGAGGCAGAGAGAGCTTGG + Intronic
1058556988 9:106179649-106179671 GTGGAGAGTCAGACAAAACAAGG - Intergenic
1058619061 9:106863962-106863984 GGGGACAGGCAGACAGAAGGGGG - Intronic
1058757846 9:108100296-108100318 TTGTGGAGGAAGACAGAGGAGGG + Intergenic
1058761519 9:108138260-108138282 GACTACAGGCAGACAGAGGAAGG + Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059071605 9:111143364-111143386 GTGGAGGGGTAGAGAGAGGGAGG - Intergenic
1059214969 9:112553054-112553076 GTGGAGGGGAGGGCAGAGGATGG - Intronic
1059636063 9:116171763-116171785 CTGGAGAGGCAGTCAGATGCTGG + Intronic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060484008 9:124035768-124035790 GTAGACAGGGAGAGAGAGGAAGG + Intergenic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1060775167 9:126367671-126367693 GTGCAGGGGCAGACACAGTATGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060871850 9:127049125-127049147 GTGGAGAGCCAGGCAAAGCACGG - Intronic
1061410338 9:130417609-130417631 GTGGAGACAGAGGCAGAGGATGG + Intronic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061618911 9:131798249-131798271 GTGGTGGGGAAGACTGAGGAAGG - Intergenic
1061747316 9:132749938-132749960 GAGGTAAGGAAGACAGAGGAAGG - Intronic
1061905734 9:133695975-133695997 GTAGAGAGGAAGGCAGAGGTAGG + Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1062190541 9:135245744-135245766 GTGGAGACGGAGGCAGAGGCTGG - Intergenic
1062261853 9:135666815-135666837 GGGGAGGGGCAGAGAGGGGAGGG - Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1203608542 Un_KI270748v1:76009-76031 GTGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203670459 Un_KI270755v1:6961-6983 GTGGAGGGACAGACACAGGCGGG + Intergenic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1185569083 X:1119052-1119074 GAGGAGAGAGAGAGAGAGGAGGG - Intergenic
1185577116 X:1183116-1183138 GTGGAGAGGGAGGCAGAGACTGG - Intergenic
1185615315 X:1418552-1418574 GAGGAGAGGCATTCAGAGGTTGG + Intronic
1185629045 X:1502805-1502827 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185629103 X:1503132-1503154 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185630855 X:1514867-1514889 GGGGAGAGGAAGACAGGGGAAGG - Intronic
1185907067 X:3944871-3944893 GGGGAGAGAGAGAGAGAGGAAGG - Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1187179596 X:16931484-16931506 GTGGAGAGGCCCACATAAGAAGG + Intergenic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1187726589 X:22209665-22209687 GAGGAGAGGGAGGGAGAGGAAGG - Intronic
1187829380 X:23365494-23365516 GGGGAGAGAAAGAAAGAGGAAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1188585775 X:31773074-31773096 GAAGTGAGGCAGACAGAGTAAGG - Intronic
1189129696 X:38485398-38485420 GGGGAGAGGCAGATTGGGGAAGG + Intronic
1189313099 X:40033660-40033682 GGGGAAAGGCAGAGAAAGGAAGG + Intergenic
1189328034 X:40124985-40125007 GTGTTGGGTCAGACAGAGGATGG + Intronic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189549885 X:42082130-42082152 GGGGAAAGGCAGAGAAAGGAGGG - Intergenic
1190559642 X:51674112-51674134 GTAGAGCGGAAGACAAAGGAAGG + Intergenic
1190564649 X:51719209-51719231 GTAGAGCGGAAGACAAAGGAAGG - Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192005585 X:67208528-67208550 CTTGAGAGGCAGACAGAACAGGG + Intergenic
1192602829 X:72482736-72482758 GTTAAGAGGCAGACAGACGTGGG + Intronic
1193331579 X:80240591-80240613 GAGGAGAGGAAGACAGATAAGGG - Intergenic
1194656488 X:96580301-96580323 GTAGAGAGAGAGAGAGAGGAAGG + Intergenic
1194745247 X:97621017-97621039 TTGGAGGGGTAGACAGAGGGAGG - Intergenic
1195520404 X:105822689-105822711 GTGGCGTGGGAGATAGAGGAGGG - Exonic
1195792622 X:108605351-108605373 GTGGAGAGGGAGAGAGATGCGGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1197264055 X:124347269-124347291 GTCGAGATGCTGAGAGAGGAGGG + Intronic
1197743786 X:129916495-129916517 GCGGAGAGGGAGACAGTGAAGGG - Intronic
1197838240 X:130718092-130718114 GTGGTGAGGGAGACACAGAAAGG - Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198438975 X:136643475-136643497 GTGGAGAGGCAGGAAGACCAGGG - Intergenic
1199598831 X:149528533-149528555 GGAGAGAGGGAGAGAGAGGAAGG - Intronic
1199741237 X:150738595-150738617 GTGAAGAGGTAGCCAGAGGGTGG - Intronic
1199974568 X:152885524-152885546 TGGGAGAGGGAGTCAGAGGAGGG - Intergenic
1200136884 X:153879578-153879600 GTAGAGAGACAGACAGAGGGTGG + Intronic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic
1201146336 Y:11067237-11067259 GAAGAGAGGGAGAGAGAGGAAGG + Intergenic
1201452962 Y:14136122-14136144 GTGGAGAGGGAGGGAGGGGATGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic