ID: 1157129575

View in Genome Browser
Species Human (GRCh38)
Location 18:44993714-44993736
Sequence CTGCTTGTTGAAATTTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157129575 Original CRISPR CTGCTTGTTGAAATTTTGAC TGG (reversed) Intronic
908705385 1:66948435-66948457 CTGTTTATTGAAATCTTGTCAGG + Intronic
909095603 1:71283963-71283985 CTTCATCATGAAATTTTGACAGG + Intergenic
912218027 1:107638629-107638651 AAGCTTGTTGAGATTTTGATTGG - Intronic
912898010 1:113614411-113614433 TTGCTTGCTGAAATTCTCACTGG + Intronic
913930020 1:124946360-124946382 CTGCTTGTGGATATTTGGAGTGG - Intergenic
914383614 1:147145288-147145310 ATGCTTGCTGAGATTTTGAGTGG + Intergenic
917364274 1:174212071-174212093 CTCTTTGTTGATTTTTTGACTGG - Intronic
918463404 1:184798078-184798100 CTGCTTGATGAAACTCTGAAAGG - Exonic
919520198 1:198578828-198578850 AAGCTTGATGAAATTTTGACTGG + Intergenic
920642502 1:207766671-207766693 CTGCTTTTTAAAATTTTGTTTGG - Intronic
920643628 1:207779034-207779056 CTTTTTGTAGTAATTTTGACTGG + Intronic
921126701 1:212184309-212184331 CTGCAGGTTGATAATTTGACTGG + Intergenic
922277020 1:224088553-224088575 TTACTTGTAGAAATTTTTACAGG - Intergenic
923969330 1:239181999-239182021 CTGCTTGTTATAAATTTGATTGG + Intergenic
1062932357 10:1361587-1361609 ATGCTTGTTGAACTCTTGGCCGG - Intronic
1065110325 10:22434822-22434844 CTGTTTATTGCAATTTTGTCGGG - Intronic
1065605170 10:27411252-27411274 ATGGTTGTTGGAATTTTGATGGG - Intronic
1066699283 10:38109733-38109755 CTGTTTGTAGAAATTGTGAATGG - Intronic
1067791120 10:49288508-49288530 CTGCTTCTTGAAGTTTCGAGAGG - Intergenic
1069017567 10:63447516-63447538 AAGCTTAGTGAAATTTTGACTGG - Intronic
1070001339 10:72380083-72380105 CTGCTTGCTGTGATTATGACTGG - Intronic
1071419095 10:85472063-85472085 ATGGCTGTTGAAATTTTGATAGG - Intergenic
1072733319 10:97862925-97862947 CTGCTTCTTGAAATTTCCTCAGG - Intronic
1075490602 10:122865109-122865131 CTGCTGGTTGGAATTTTAAATGG - Intronic
1080327755 11:31097739-31097761 ATGCTAGTTAAAATTTTGAACGG - Intronic
1080649176 11:34209394-34209416 CTGCTTTTTGAAATTTAGGGAGG + Intronic
1081368433 11:42266314-42266336 TTGCTTATTGAAAATTTGAGAGG + Intergenic
1082164980 11:48937288-48937310 CTGCAAGTGGAAATTTGGACTGG - Intergenic
1087469784 11:98557816-98557838 CTTCTTTTTAAAATTTGGACAGG + Intergenic
1087637879 11:100723315-100723337 CTGCTTGCTGGGATTTTGATTGG + Intronic
1090010281 11:123039930-123039952 CTATTTGTTGAGATTGTGACAGG - Intergenic
1091388698 12:111952-111974 CTGCTTGTTGAAACTGTGCTGGG - Intronic
1092761005 12:11811312-11811334 CTGCTTCTTGGAATTATCACTGG - Intronic
1093527650 12:20121171-20121193 CTGCTTGTTTTTATTTTGCCTGG - Intergenic
1094590741 12:31817546-31817568 CTGTGGGTTGAAATTTGGACTGG - Intergenic
1095585125 12:43841196-43841218 CTGCTAGTTGAAATTGTTAGTGG + Intronic
1096168236 12:49444013-49444035 ATGCTTGCTGAAATTTTAATAGG + Intronic
1097943814 12:65344202-65344224 CTGCTTGTTGGAATAGAGACTGG + Intronic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1102366925 12:112345583-112345605 TTGCTTTTTCAAATTTTGTCAGG + Intronic
1104234983 12:126925424-126925446 ATGCTGGTTAAAATTGTGACAGG - Intergenic
1104394196 12:128417762-128417784 ATGCTTATTGAAGGTTTGACGGG - Intronic
1105067354 12:133212284-133212306 CTGCTTGGTGAAATTATGCTGGG + Intergenic
1106095649 13:26640833-26640855 GTGCTTGGGGAGATTTTGACAGG + Intronic
1107777959 13:43866472-43866494 AAGCCTGCTGAAATTTTGACTGG + Intronic
1108755741 13:53499935-53499957 CTTCTTATTTAAATATTGACTGG + Intergenic
1108973536 13:56406122-56406144 TTCCTTGTTGAATTTTTGTCTGG - Intergenic
1110351897 13:74518728-74518750 ATACTTTTTGAAATTTTAACTGG + Intergenic
1111423580 13:88050609-88050631 CTGTTTATTGTAATTTTGACTGG - Intergenic
1114176597 14:20326396-20326418 CTGCTTGTTGGAATTCATACTGG - Intronic
1114757781 14:25279921-25279943 CTGATTGTAGAAATTTTGAATGG - Intergenic
1114989466 14:28269412-28269434 CTTTTTGTGGAAATTTTGAAAGG - Intergenic
1116735469 14:48685391-48685413 CTGGTTCTTGATATGTTGACAGG - Intergenic
1117074352 14:52087419-52087441 CTGATTTTTGAAATTTTCAAGGG - Intergenic
1119154911 14:72401030-72401052 CTGCTGATAAAAATTTTGACTGG + Intronic
1119960598 14:78851545-78851567 CTTCTTGCTGAAAGTTTTACCGG - Intronic
1120066730 14:80050125-80050147 ATGCTTGTTGGAATTTTGCTAGG - Intergenic
1120196098 14:81484556-81484578 CTTCTAGTTTAAATTTTTACTGG - Intronic
1120315276 14:82884945-82884967 CTGCTTCTTGAGGTTTGGACTGG + Intergenic
1121993539 14:98584091-98584113 CTGCTTGTTGAGATGTTGTAGGG - Intergenic
1126033404 15:44522942-44522964 TTGCTTGATGAAACTTTGGCAGG + Intronic
1128413310 15:67420850-67420872 CTGCTTTTTGAAGGTTTGACAGG - Intronic
1132000326 15:98172975-98172997 ATGTTTGTTGAAAGTTTGAGAGG - Intergenic
1134470857 16:14524722-14524744 CTACTTGGAGAAATTTTTACAGG - Intronic
1136489326 16:30595847-30595869 ATGCATGTTGAAATGTTTACGGG + Intergenic
1137577617 16:49613128-49613150 ATTCTTGCTGTAATTTTGACTGG - Intronic
1143569944 17:7750561-7750583 CTGCTTGTTGTACATTTGGCTGG + Intronic
1143695819 17:8616727-8616749 AACCTTGTTGAAATTTTGATTGG - Intronic
1146304371 17:31719575-31719597 CTGCTTGTGGGAATGTGGACAGG + Intergenic
1149236577 17:54597748-54597770 CAGCTGGTTAAGATTTTGACTGG - Intergenic
1149964718 17:61150763-61150785 CTGCTTTTGGAACTTGTGACAGG + Intronic
1152160107 17:78663244-78663266 ATGCTTGATGGAATTTTGATTGG - Intergenic
1153801446 18:8674251-8674273 CTGCCTGTTCAAACTTGGACTGG - Intergenic
1156875198 18:42002160-42002182 CATCTTGTTGAAAGTTTTACAGG - Intronic
1157082094 18:44536371-44536393 CTGCTTGTTTAAATTTCAGCTGG + Intergenic
1157129575 18:44993714-44993736 CTGCTTGTTGAAATTTTGACTGG - Intronic
1157343158 18:46798431-46798453 TAGCTTGCTGAGATTTTGACTGG - Intergenic
1157840141 18:50949820-50949842 ATACTTGTTGAAAGATTGACTGG - Exonic
1158167707 18:54559061-54559083 CTGCTTGTTTCCATTTTGAGTGG + Intergenic
1158543298 18:58375526-58375548 CTGTTTGTTGACAGGTTGACAGG - Intronic
925195996 2:1926275-1926297 CTGCTTGTTGATGGATTGACTGG - Intronic
926908131 2:17824992-17825014 TTGCTTGTTGAAATTGTGCTGGG + Intergenic
928244469 2:29615243-29615265 CTCCTTTGTGAAATTTTCACTGG + Intronic
929089950 2:38205668-38205690 ATGCTTATAGAAATTTTGATTGG - Intergenic
931122813 2:59239133-59239155 CTGCTTGTTAATGTTTTGACTGG + Intergenic
931790834 2:65662628-65662650 CTGCATGATTAAATTTTGGCAGG - Intergenic
933534358 2:83553748-83553770 CTCCTTGTTGCAATTATGAATGG + Intergenic
934923293 2:98363399-98363421 CTCTTTGTAGAAATTTTGAGTGG + Intronic
935260178 2:101348334-101348356 ATCCTTGTTGAGATTTTGATAGG + Exonic
935825228 2:106941314-106941336 CTGCTGGATGATATGTTGACAGG + Intergenic
936985518 2:118308776-118308798 CTGCTTGTTGAATATTTTCCTGG + Intergenic
937385896 2:121432527-121432549 ACGCCTGTTGAAATGTTGACTGG + Intronic
938075332 2:128329784-128329806 CTGCTGGTGGAAATATTCACTGG - Intergenic
938391209 2:130907618-130907640 CTGATTGTGGAGATTATGACTGG + Intronic
939094097 2:137813249-137813271 CTGCTTCTTGAAATAGTAACTGG - Intergenic
939106513 2:137954667-137954689 ATGCTGGTTGAAATTGTGACAGG - Intergenic
939361849 2:141182890-141182912 ATGCTTATTTACATTTTGACAGG - Intronic
940926132 2:159365478-159365500 CCACCTGTTGAAATTATGACAGG - Intronic
944860765 2:203813827-203813849 CTCCCTGTTGAATTTGTGACAGG - Intergenic
945756017 2:213847731-213847753 CTGCTTGTTTAAACTCTGCCTGG - Intronic
947879145 2:233489964-233489986 CTGCTTGTTCTAATTCTGAAGGG + Intronic
1169651064 20:7867949-7867971 CTACTTGGTGAAATATTGTCGGG + Intergenic
1172868599 20:38120420-38120442 CTGCTTGTGGAAACTCTGAGGGG - Intronic
1176871655 21:14087427-14087449 CTGCCTGTTGACAATTTGAGGGG + Intergenic
1177293388 21:19144363-19144385 CTGCTTGGTGAAAATTTTATTGG - Intergenic
1177908030 21:26995374-26995396 CTTTTTGTTGAAATATTGAGTGG + Intergenic
1178166880 21:29988663-29988685 ATCCTTGCTGAAATTTTGGCAGG - Intergenic
1178346931 21:31837477-31837499 CAGTTTGTTGCAATTTTGACAGG + Intergenic
1179096187 21:38317346-38317368 CAGCTGGTTGAAATTTTGGTTGG - Intergenic
1180260970 21:46668373-46668395 CTGCTTGTTGAAGTCTTCCCAGG + Intergenic
1180508063 22:16038520-16038542 CTGCAAGTTGACATTTTGAGAGG - Intergenic
1180851157 22:19021942-19021964 CCTCTTGTTGAATTTTTTACTGG - Intergenic
1181348162 22:22235611-22235633 CTGCTTGTTGAAAGTGTGCTGGG + Intergenic
1181799638 22:25336364-25336386 CTGCTTGTTGAAATTGTTCTGGG - Intergenic
1182175795 22:28286968-28286990 CATCTTGCTGGAATTTTGACTGG - Intronic
1184392074 22:44208685-44208707 AAGCCTGCTGAAATTTTGACTGG + Intronic
950561580 3:13732144-13732166 CTTTTTGTAGAAATTTTGAATGG + Intergenic
953736375 3:45497554-45497576 CTGCAGGTTGAAATTCTGGCAGG - Intronic
953853950 3:46486343-46486365 TTGCTTGTTGAAACTTTGCTGGG + Intergenic
957030010 3:75229376-75229398 CTTCTTGTTGAAACTATGAGGGG + Intergenic
957840748 3:85666132-85666154 CTGTTTGTAGAAATTGTGAATGG - Intronic
959619315 3:108382917-108382939 TTCCTTGTTGAAATTTTCCCAGG - Intronic
959948985 3:112157556-112157578 ATGCTTGTTGGTATTTTGATAGG + Intronic
960525983 3:118710181-118710203 CTGTTTTTTAAAAATTTGACAGG - Intergenic
961011808 3:123441346-123441368 CTGCTTGGTGAAAGTTTGGATGG - Intronic
963572128 3:147010713-147010735 CTGCTTGTTGATTTTTAGAATGG - Intergenic
965111851 3:164435119-164435141 CTGCTTATTTAAATTTTTATTGG - Intergenic
965876174 3:173323628-173323650 CTGCTTTTAGAAAATTTGGCTGG + Intergenic
967000961 3:185334268-185334290 TTGCCTGCTGAAATTTTGATTGG - Intronic
967056632 3:185834836-185834858 CTCGTGGTTGAAATTTTGATGGG - Intergenic
971370839 4:26017515-26017537 CTGCTTGTTGAAATTAACAGGGG + Intergenic
972434078 4:39014895-39014917 CTGTTTCTTGAAAGTTTGGCAGG + Intronic
973030228 4:45328670-45328692 CTCCTTGATCAAATTTAGACAGG + Intergenic
973714821 4:53665558-53665580 CTCTTTGTTGAAATTGTGAATGG + Intronic
977173182 4:93787737-93787759 CTGCTTGTTGAATTATTGAATGG + Intergenic
977586045 4:98776408-98776430 GGCCTTGTTGAGATTTTGACTGG + Intergenic
983411945 4:167410720-167410742 CTGCTACTAGAAATTTTGTCTGG - Intergenic
984421514 4:179528362-179528384 TTGCTTGTTGATATTTTGAAGGG - Intergenic
984482883 4:180328381-180328403 ATCCTTGCTGAAATTTTGATGGG + Intergenic
985198773 4:187462308-187462330 CTGCTTCTCCAAATTTTAACAGG - Intergenic
986406533 5:7431086-7431108 CTGCTTTTTCAAATTTTAAGGGG - Intronic
986591245 5:9373164-9373186 TTGCTTTGTTAAATTTTGACAGG - Intronic
988005856 5:25408985-25409007 CTCTTTGTAGAAATTTTGAATGG - Intergenic
988340723 5:29967525-29967547 CTTTTTGTGGCAATTTTGACTGG - Intergenic
989324628 5:40177497-40177519 CTGTTTTTTGAAGTTTTGAAAGG + Intergenic
989538424 5:42590736-42590758 ATGCTTGTTGACATTCTAACAGG + Intronic
989896031 5:47084841-47084863 CTGCAAGTGGATATTTTGACAGG - Intergenic
992284116 5:75215056-75215078 CTGCCTGTTGACCTTTAGACTGG - Intronic
994185409 5:96809691-96809713 CTGCATGTTCAGAATTTGACAGG + Intergenic
994927140 5:106130905-106130927 TTCCTTTTTGAAATTATGACTGG - Intergenic
995764862 5:115603515-115603537 CTGCTTGTTAAAATTCTTTCAGG + Intronic
996652297 5:125894007-125894029 TTGCTTCTTCTAATTTTGACTGG - Intergenic
997217056 5:132121081-132121103 CTCTTTGTAGCAATTTTGACTGG - Intergenic
1001346847 5:170910069-170910091 CTGCTTGCTTATATTTTGATAGG + Intronic
1001968089 5:175928475-175928497 TAACTTGCTGAAATTTTGACTGG - Intronic
1002249353 5:177915331-177915353 TAACTTGCTGAAATTTTGACTGG + Intergenic
1202771557 5_GL000208v1_random:5468-5490 CTGCAAGTGGATATTTTGACAGG - Intergenic
1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG + Intronic
1003798084 6:9628769-9628791 TTGCTTGTTGATATTCTGTCTGG + Intronic
1004755463 6:18605879-18605901 CTGCTTTTTAAAATATTGCCAGG - Intergenic
1005642080 6:27806325-27806347 GTGCATTTTAAAATTTTGACAGG + Intergenic
1008568024 6:52788138-52788160 CTGCCTGTTGAAACTTGGCCTGG + Intergenic
1008993860 6:57635906-57635928 CTGCTTTTTAAAATTTTCAGTGG + Intronic
1009765456 6:68068849-68068871 CTGTTTGTTGACAATTTCACTGG - Intergenic
1010823826 6:80448630-80448652 GTGTGTGTTGAAATTTTTACAGG - Intergenic
1014019746 6:116573442-116573464 AAGCTTGTAGAAATGTTGACAGG - Intronic
1014760400 6:125350341-125350363 CTGGTTGTAGAGATTTTAACTGG + Intergenic
1014901653 6:126972927-126972949 CTGCTTGCTCAAAATTTGCCCGG - Intergenic
1015357697 6:132298315-132298337 TTATTTGTTTAAATTTTGACCGG - Intronic
1015910064 6:138161414-138161436 CCGCGTGTTGAAAGCTTGACTGG + Intergenic
1016955480 6:149622692-149622714 CAGCTTATTGAAATTTGGGCTGG + Intronic
1018322514 6:162626936-162626958 CAGCTTGTTCAAAATTTGAATGG - Intronic
1020423918 7:8042107-8042129 CTGCTTATTGACAATTTGCCTGG + Intronic
1021076598 7:16312157-16312179 TAGCTTGCTGAAATTTTGATTGG + Intronic
1021565477 7:22012419-22012441 CTACTTGCTGGAATGTTGACAGG - Intergenic
1022062835 7:26817828-26817850 CTTCTTGTTGCAATTGTGAATGG - Intronic
1022064328 7:26835581-26835603 CTTCTTGTTGCAATTGTGAATGG - Intronic
1022309826 7:29186416-29186438 CTGCTTTTTAAAATTTTTAGTGG - Intronic
1023692312 7:42802727-42802749 CTGCCTTTTGTAATTTTAACTGG - Intergenic
1023977965 7:45046166-45046188 ATTCTTGCTGAAATTTTGATAGG - Intronic
1024480934 7:49862015-49862037 ATGGTTGTTGGAATTTTGAAAGG + Intronic
1024621042 7:51158276-51158298 CTCCTTTTTGAAATTTTGCATGG - Intronic
1028965616 7:96798067-96798089 CTGCTTGATAAAATTTTGTAAGG + Intergenic
1034076147 7:148233087-148233109 TTGTTTGTTTATATTTTGACTGG - Intronic
1035849781 8:2905645-2905667 AACATTGTTGAAATTTTGACAGG - Intergenic
1036789082 8:11705635-11705657 CTGGTTGTTGAAATTGAGCCTGG - Intronic
1039011129 8:33094130-33094152 ATGCCTGTTGAAATATTGGCTGG - Intergenic
1041109031 8:54468150-54468172 CTGTTTGTTTATTTTTTGACAGG + Intergenic
1041132629 8:54718173-54718195 TAGCTTGCTGGAATTTTGACTGG - Intergenic
1043743016 8:83837628-83837650 CTGCTTGTTGAAATGTAAAATGG + Intergenic
1044719121 8:95128831-95128853 CTGCATGTTCAAATTTATACTGG + Intergenic
1046587956 8:116170641-116170663 CTGTTTGTTCAATTTTTGAATGG + Intergenic
1047947064 8:129891019-129891041 CTGCTGGAAGAAATTATGACAGG - Intronic
1050910713 9:11065792-11065814 GAGCTTGTTGGAATTTTGATAGG + Intergenic
1051794473 9:20849360-20849382 CTGCTTCTTGAAACTTTTTCTGG + Intronic
1052200433 9:25772013-25772035 CTGCTTCATGTAATTTTGCCTGG + Intergenic
1057143358 9:92741263-92741285 CTGTTTGCTGAGATTTTGTCAGG - Intronic
1059242308 9:112817504-112817526 CAGCTCGTTGAATTTTTAACTGG + Intronic
1059609149 9:115873206-115873228 CTGCTTGTGGAAATGTAAACTGG - Intergenic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1189170439 X:38904177-38904199 GTGCTAATTGAATTTTTGACTGG + Intergenic
1190575112 X:51828056-51828078 ATGCTTGCTAAAATTTTGATTGG + Intronic
1190898469 X:54644803-54644825 TTGCCTATTGACATTTTGACCGG + Intergenic
1194278684 X:91919939-91919961 CAGCTTGTTGAAAATTTGCTTGG + Intronic
1194332256 X:92598286-92598308 CTGCTTGTTAAAACCTTGTCTGG - Intronic
1195438934 X:104879191-104879213 TTGCTAGTTGAAATTTAGAATGG + Intronic
1196275010 X:113756475-113756497 CTACTTTTGGAAAATTTGACGGG - Intergenic
1196610471 X:117708492-117708514 AAACTTGTTGAAATTCTGACTGG + Intergenic
1198851451 X:140968963-140968985 CTGCTTGTTAAAAGTTTGCTGGG + Intergenic
1200596169 Y:5143442-5143464 CAGCTTGTTGAAAATTTGCTTGG + Intronic