ID: 1157131205

View in Genome Browser
Species Human (GRCh38)
Location 18:45009018-45009040
Sequence GCAATTGCCACCGTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157131199_1157131205 26 Left 1157131199 18:45008969-45008991 CCTCACGTGGAGCTGGCTTTCAC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157131205 Original CRISPR GCAATTGCCACCGTGTGCTG TGG Intronic
900340907 1:2188639-2188661 GCTCCTGCCACCGTGTGCTGCGG - Intronic
902668839 1:17958018-17958040 GAATTTGCCATCGTGTGCTGGGG + Intergenic
904596801 1:31651925-31651947 GAAAATGCCACCCGGTGCTGAGG - Intergenic
905255605 1:36680642-36680664 GGAAGGGCCAACGTGTGCTGAGG + Intergenic
905922941 1:41731154-41731176 GCAAATGCCACTGAGTGTTGGGG + Intronic
911732679 1:101306972-101306994 GCAATTGCTATAGAGTGCTGAGG + Intergenic
912262888 1:108126760-108126782 GCAATTGCCAGCATCTGCTTTGG - Intergenic
913199395 1:116483903-116483925 GCAAACGCCACCCTGTGCTATGG - Intergenic
913520187 1:119638314-119638336 GCAATTAACACTGTCTGCTGAGG - Intronic
913961478 1:143340770-143340792 GCAGCTGCCACCGTGAGCAGTGG - Intergenic
914055831 1:144166343-144166365 GCAGCTGCCACCGTGAGCAGTGG - Intergenic
914123315 1:144800019-144800041 GCAGCTGCCACCGTGAGCAGTGG + Intergenic
915045666 1:153012754-153012776 TAAGATGCCACCGTGTGCTGTGG + Intergenic
923296616 1:232600767-232600789 GCAACTGCCACCTTCTGCTCTGG - Intergenic
1067029936 10:42873166-42873188 GCAGCTGCCACCGTGAGCAGTGG - Intergenic
1076367137 10:129928678-129928700 GCAATTGCCAAAATGTCCTGTGG - Intronic
1078084360 11:8224880-8224902 GGAATTGCCCAGGTGTGCTGTGG - Intronic
1083893607 11:65609287-65609309 GCACTTGCCACAGTGTGATGTGG - Intronic
1084139470 11:67215463-67215485 GCATCTTCCTCCGTGTGCTGTGG + Intronic
1088860807 11:113797536-113797558 GCAATTGCCGGTGTCTGCTGAGG + Intergenic
1090710152 11:129376342-129376364 GCAATGCCCACCGCTTGCTGAGG - Intronic
1092505655 12:9096488-9096510 GAAAATGCCATCGTGTCCTGTGG - Intronic
1095087107 12:38069078-38069100 GCAATTGTCACAGGGTCCTGAGG - Intergenic
1098184709 12:67883855-67883877 GTCATTGCCACCATGTACTGAGG - Intergenic
1099367573 12:81787630-81787652 GCAAATGCCTGCCTGTGCTGGGG - Intergenic
1101503590 12:105326743-105326765 GAAGTTGCTACCGGGTGCTGAGG + Intronic
1104430190 12:128709987-128710009 GAACCTGCAACCGTGTGCTGAGG - Intergenic
1113850998 13:113418029-113418051 GCAATCGCCAGGGTTTGCTGAGG + Intergenic
1126597580 15:50397684-50397706 GCAAATGCCACCTTGTAATGAGG + Intergenic
1127169134 15:56280882-56280904 GTAATTTCAACCATGTGCTGGGG + Intronic
1135110473 16:19687006-19687028 GCAATTGCAATAGTGTGCAGAGG - Intronic
1139955323 16:70690409-70690431 GGACTTGCCACACTGTGCTGTGG - Intronic
1140453841 16:75093095-75093117 GCAAATGCCACCGGGCGCGGTGG + Intronic
1144559977 17:16313105-16313127 ACAATGTCCACCGTGTCCTGGGG - Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1149204164 17:54224517-54224539 GGAATTTCCATCTTGTGCTGGGG + Intergenic
1150499389 17:65635925-65635947 GCAATTTCCAGGCTGTGCTGTGG - Exonic
1152316291 17:79582513-79582535 GCAATTCCAACCGGGTGCGGTGG + Intergenic
1153462845 18:5355626-5355648 GTAATGGCCACCGTGTTCTTAGG + Intergenic
1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG + Intronic
1158154651 18:54411747-54411769 GAAATTGCAACTGTGAGCTGAGG - Intergenic
1159900589 18:74041178-74041200 GCTATGGCCCCCGTGTGCAGTGG - Intergenic
1202695316 1_KI270712v1_random:119020-119042 GCAGCTGCCACCGTGAGCAGTGG - Intergenic
932903224 2:75723846-75723868 TCCATTGGCACCGGGTGCTGTGG - Intergenic
934020718 2:87948666-87948688 ATAATTGCCACCGGGTGCGGTGG - Intergenic
934276483 2:91576068-91576090 GCAGCTGCCACCGTGAGCAGTGG - Intergenic
935653710 2:105403978-105404000 GCAACTGCCACCCTGTGGTGGGG + Intronic
936116629 2:109707982-109708004 GCAAGTGCCATCCTGTACTGAGG + Intergenic
941782383 2:169459217-169459239 GCTATTGCCACCGTAAGCTGGGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175975245 20:62707676-62707698 GCCAGTGCCACCAGGTGCTGGGG + Intergenic
1179470350 21:41606047-41606069 GCAAATGGCCCCATGTGCTGAGG + Intergenic
1182414508 22:30212504-30212526 GCAAGTGCCTCCCTCTGCTGAGG - Intergenic
950063453 3:10091805-10091827 GCAACTACCACCGGGTGCAGTGG + Intronic
955020216 3:55113306-55113328 GCCATTGCCACCCTGTCTTGTGG - Intergenic
955344594 3:58151782-58151804 ACATTTGCCACCCTGTGCTCAGG + Intronic
955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG + Intronic
965789472 3:172372333-172372355 GATATTGCCAGCGTGGGCTGGGG + Intronic
967009555 3:185419330-185419352 CTAATTGTCACTGTGTGCTGAGG - Intronic
970333244 4:15004535-15004557 GCAGTGGCCACCGTGGGCTGTGG + Intronic
980634620 4:135484534-135484556 GCACAAGCCACCATGTGCTGGGG + Intergenic
982943389 4:161587513-161587535 GTAATTGCCAACGTGAGTTGTGG + Exonic
991091464 5:62697472-62697494 TGAATTTCAACCGTGTGCTGAGG - Intergenic
991409043 5:66328894-66328916 GTAATTCCCAGCGTGTGCTTTGG - Intergenic
1004312117 6:14554894-14554916 GCAATGGCCACCTGGAGCTGAGG - Intergenic
1006781517 6:36635677-36635699 GCATTCTCCACCCTGTGCTGTGG - Intergenic
1011628544 6:89302697-89302719 GCAGTGGCCACCGTGTTCCGGGG + Intronic
1011706234 6:90003960-90003982 GCTGTTGTCACCCTGTGCTGTGG + Intronic
1019388580 7:772700-772722 GCACTTGCCACCATGCACTGGGG - Intronic
1028603189 7:92625334-92625356 CCATTTGCCACCATGTGGTGAGG + Intronic
1029677012 7:102076735-102076757 GTAATTGCGACCGGGTGCAGTGG + Intronic
1035098806 7:156379582-156379604 GCAATTGCCACCAATTGATGGGG - Intergenic
1037608951 8:20460233-20460255 GCAATTGCCAAAGTGTTTTGTGG - Intergenic
1039575674 8:38622003-38622025 GTAAATGCAACCGGGTGCTGAGG - Intergenic
1041530353 8:58858659-58858681 GCATTTGACACCCTGAGCTGTGG + Intronic
1042878043 8:73457820-73457842 CTAATTGCCACCCTGGGCTGGGG + Intronic
1043286347 8:78536557-78536579 GCAGTTGCCACCTTGTCCTCAGG - Intronic
1045227359 8:100262244-100262266 GCATTTGTCACCGTGTGATTGGG - Intronic
1045582221 8:103494566-103494588 GCACTTGTCACAGTGTGTTGTGG - Intergenic
1046133800 8:110000136-110000158 GAAATTGCAACCTTGTGGTGTGG + Intergenic
1048570510 8:135650986-135651008 GCAAGTGCCACAGTCTACTGGGG + Intronic
1051250336 9:15152533-15152555 GCAAATGCTACCTGGTGCTGTGG + Intergenic
1052334671 9:27307320-27307342 GCAATGGTCACAGTGTCCTGGGG + Intergenic
1058173441 9:101710548-101710570 CCAATTTCCACCCTGTTCTGTGG + Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1199123806 X:144090461-144090483 ATAATTGCCACCGGGTGCGGTGG + Intergenic
1199476226 X:148248299-148248321 GCAAATGACAGCCTGTGCTGAGG + Intergenic