ID: 1157134341

View in Genome Browser
Species Human (GRCh38)
Location 18:45039314-45039336
Sequence GGGGCTGGTGGGAGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1334
Summary {0: 1, 1: 1, 2: 23, 3: 176, 4: 1133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157134341_1157134353 19 Left 1157134341 18:45039314-45039336 CCACAGTGCCTCCCACCAGCCCC 0: 1
1: 1
2: 23
3: 176
4: 1133
Right 1157134353 18:45039356-45039378 TCAGTCTCATCCCTGCCTCCAGG 0: 1
1: 0
2: 7
3: 41
4: 810
1157134341_1157134354 27 Left 1157134341 18:45039314-45039336 CCACAGTGCCTCCCACCAGCCCC 0: 1
1: 1
2: 23
3: 176
4: 1133
Right 1157134354 18:45039364-45039386 ATCCCTGCCTCCAGGAAGACAGG 0: 1
1: 0
2: 1
3: 39
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157134341 Original CRISPR GGGGCTGGTGGGAGGCACTG TGG (reversed) Intronic
900000982 1:14787-14809 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900020697 1:185308-185330 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900166624 1:1246598-1246620 GGGCCCGGCGGGAGGCACAGAGG - Exonic
900291604 1:1926074-1926096 GCGGCTGGTGTGAGGGCCTGGGG + Intronic
900300831 1:1976269-1976291 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
900513338 1:3070322-3070344 CGGGCTGCTCGGAGGCGCTGTGG - Intronic
900524192 1:3120516-3120538 GGGGATGGTGGCAGACACTCTGG - Intronic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900611475 1:3546388-3546410 GGTGTTGGTGGGAGGCACCTTGG - Intronic
900648781 1:3720963-3720985 GGGGCTGGTGAGGGGCACAGAGG + Intronic
900685316 1:3944481-3944503 GGGGCATGTGGGAGGGACAGAGG - Intergenic
900717515 1:4154482-4154504 GGTGACGGTGTGAGGCACTGAGG - Intergenic
900865021 1:5262559-5262581 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
900884581 1:5405316-5405338 GGGGCAATTGGGAGGCAATGGGG - Intergenic
901025652 1:6277500-6277522 AGGGCTGGTGGGAGTCTATGGGG - Intronic
901109817 1:6785594-6785616 GGGGCTGGGGGGCGGCGCGGCGG + Intronic
901199174 1:7457056-7457078 GGGGCGGGTGAGGGGCACGGCGG - Intronic
901216700 1:7559210-7559232 GGGGTGCGTGGGAGGCTCTGGGG - Intronic
901405990 1:9046145-9046167 GTGACTGGAGGGAGGCAGTGAGG + Intronic
901512562 1:9724722-9724744 GGGGCTGGTTGGATGCAGAGCGG + Intronic
902176293 1:14653398-14653420 GGGGCCCGTGGGAGACAATGGGG + Intronic
902323314 1:15683556-15683578 GGGGCCTGTGGGAGTCTCTGGGG + Intergenic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902653686 1:17853188-17853210 GGGGCTGTTGGCAGGCGCAGTGG - Intergenic
902768030 1:18630028-18630050 GGTGCTGGTGTGAGGATCTGGGG - Intergenic
902977030 1:20096302-20096324 GAGGCTTGTGGCAGGCACTAGGG - Intergenic
903063614 1:20686215-20686237 GGGGGTGGTGGGAGGCCTTGGGG - Intronic
903334695 1:22617011-22617033 GGCTCTGGTGGGAGGGGCTGTGG + Intergenic
903376636 1:22870495-22870517 GGGGCAGGAGGGAGGGACAGAGG + Intronic
903659623 1:24969168-24969190 GTGGCTGGTGGGAGGAGATGTGG + Intergenic
903708193 1:25302375-25302397 GGCTCGGGTGGGAGGCACTGGGG + Intronic
903718916 1:25390038-25390060 GGCTCGGGTGGGAGGCACTGGGG - Intronic
903809725 1:26028616-26028638 GGGGTAGGTGGGAGGAACAGAGG + Intronic
903929673 1:26855085-26855107 GGGGCTGGTGGGTAGGGCTGGGG - Exonic
903963180 1:27070202-27070224 GGGACTTGGGGGAGGCAGTGAGG + Intergenic
904009199 1:27380357-27380379 GCGCCTGGTGGGAGGAACAGTGG + Intronic
904377439 1:30090572-30090594 CTGGCTGGTGGGAGGGCCTGGGG + Intergenic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
904670788 1:32163407-32163429 GGTCCTGATGGGAGGCACTATGG + Intronic
905375873 1:37519875-37519897 GGGCCTGGTGGGAGGGATTTAGG - Intergenic
905462520 1:38130971-38130993 GTGTCTGGTGGGGGGGACTGAGG - Intergenic
906125085 1:43422763-43422785 GGGGCTGGTCTGGGGCACTGGGG - Exonic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906248884 1:44296141-44296163 GGCACTGCTGGGAGGCACGGTGG - Intronic
906517372 1:46447770-46447792 GGAGCAGGTGGGAGGGACTCGGG + Intergenic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
906949870 1:50326155-50326177 GGGGCGAGGGGGAGGCCCTGGGG + Intergenic
907360301 1:53908637-53908659 GAGGGTGGGTGGAGGCACTGAGG + Intronic
907439922 1:54472841-54472863 GGGGCTGGAGGAAGGCATAGGGG - Intergenic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
907931734 1:59007099-59007121 GGGGCTGCTGGCAGGAACTACGG - Intergenic
908033803 1:60030165-60030187 GGGCATTGTGGTAGGCACTGAGG - Intronic
908127325 1:61044061-61044083 GGGCCTGGTGGGTGACAGTGAGG + Intronic
908177136 1:61566711-61566733 GGGGCAGGTGGGAGGTATTTGGG - Intergenic
908250611 1:62262869-62262891 GGGGAGGGTGGAAGGCAGTGAGG + Intronic
908326496 1:63028729-63028751 GTCACTGGTGGGAGGCACAGAGG - Intergenic
908328237 1:63044610-63044632 GGAGCTGGTGGGTGGAGCTGGGG - Intergenic
908690334 1:66772458-66772480 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
910290984 1:85600183-85600205 GGACCTGGTGGGAGGCAATTGGG + Intergenic
910903974 1:92153937-92153959 GGGCCTGGTGGGAGGGATTTGGG + Intergenic
911080599 1:93925790-93925812 GTGGCTGGTGGGAGTGAGTGGGG + Intergenic
911081591 1:93938173-93938195 GGTGATGGTGGGAGGAAATGGGG - Intergenic
911254781 1:95621117-95621139 GGGGCATATGGGAAGCACTGGGG + Intergenic
911661427 1:100506072-100506094 GGGGCTAGTGGGAGGTACTTGGG - Intronic
912313750 1:108647948-108647970 GGGGCTGGTGGGAGGTGATTGGG + Intergenic
912489652 1:110055028-110055050 GGGGCAGGTGGTTGGGACTGAGG + Intronic
912516197 1:110217958-110217980 GGGGATGGGGTGAGGGACTGAGG - Intronic
912659271 1:111513937-111513959 GGAGCTGGTGGGAGGGGCTGTGG + Intronic
912712640 1:111960815-111960837 AGGGCTGGTGGGAAGCACTCTGG - Intronic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
914394725 1:147254391-147254413 GGGGAAGGTGGGAGGAAGTGAGG + Intronic
914697560 1:150099358-150099380 GGGTGTGGTGGCAGGCACAGTGG + Intronic
914803048 1:150974448-150974470 GGCGCTGGCGGGGGGCGCTGCGG - Intronic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915324685 1:155075264-155075286 GGGCTTGGTGGGTGGCATTGGGG - Intergenic
915646318 1:157275229-157275251 GGGGTTGGTGAGAGGCTCGGAGG + Intergenic
915763034 1:158334756-158334778 GGTGGTGGTGGGAGGAAATGAGG + Intergenic
916080248 1:161227742-161227764 GGGGATGGAGGCAGGAACTGTGG - Intronic
916457206 1:164983152-164983174 GGGGCTGGTGTGTGGCTTTGTGG - Intergenic
916510231 1:165466753-165466775 TGGGGTGGTAGGAGCCACTGTGG + Intergenic
916577857 1:166082959-166082981 GGGGCTGGGTGGTGGCATTGAGG + Intronic
916899679 1:169207320-169207342 GGGCCTAGTGGGAGGCATTTGGG - Intronic
917059713 1:171023898-171023920 AAGGGTGGTGGGAGGCACTGGGG - Intronic
919123611 1:193370357-193370379 GGGCATGGTGGCAGGCACTGTGG + Intergenic
919920887 1:202165841-202165863 GGGCCGGGTGGGCGGCTCTGAGG + Intergenic
919931686 1:202225302-202225324 TGGCCTGGTGGGGGGTACTGTGG + Intronic
920162035 1:204005997-204006019 GGGACTGGTGGAAGGGAGTGGGG - Intergenic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920441648 1:205984884-205984906 GGGGCTGGGAGGAGGCAGGGAGG - Intronic
920443968 1:206001820-206001842 AGGGCTGGTGCCAGGCACTGGGG - Intronic
920560595 1:206935762-206935784 GGGGGTGGCAGGAGGCTCTGTGG - Exonic
920608988 1:207419091-207419113 GGGTCTGGTGGGAGGTATTTGGG + Intergenic
920737323 1:208544688-208544710 TGGGGAGGTGGGAGACACTGAGG + Intergenic
921220596 1:212970959-212970981 GGGGCTGGAGGGGGGAAATGGGG - Intronic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921805291 1:219447021-219447043 GGGGCGGGTGGGGGGCACGGTGG - Intergenic
922184059 1:223258515-223258537 GGGGCTGGGGGGAGTCACCTGGG + Intronic
923026291 1:230207018-230207040 GTGGGTGGTGAGAGGAACTGTGG - Intronic
923055909 1:230425958-230425980 TGTGCGGCTGGGAGGCACTGTGG - Intergenic
923217030 1:231857894-231857916 TGGGGTGGTGGCAGGCACTTAGG - Intronic
924049232 1:240063620-240063642 GGGGCTGGTTGGACACACTAAGG - Intronic
924204700 1:241699580-241699602 GGGGTGGGTGGGGGGAACTGAGG + Intronic
924450538 1:244175036-244175058 GGGGCGGGGGGGAGGAACTTAGG - Intergenic
924588608 1:245381729-245381751 GGGGCTGGTGGGAGGGAGAATGG - Intronic
1062877791 10:956006-956028 GGGGCACCTGGCAGGCACTGGGG - Intergenic
1063541156 10:6935239-6935261 ATGGCTGGTGGAAGGCACTGGGG + Intergenic
1063964450 10:11335722-11335744 GGGGATGTTGGGAGGCATGGGGG + Exonic
1063970639 10:11379195-11379217 GGGGCTGGGTGGAGGCTGTGGGG - Intergenic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1064136384 10:12754287-12754309 GAGGGTGGAGGGAGGCACAGTGG - Intronic
1064261300 10:13788431-13788453 GGGCCATGTGGGAGGCATTGGGG - Intronic
1064327341 10:14363728-14363750 GGGATGGGAGGGAGGCACTGAGG - Intronic
1064464193 10:15562918-15562940 GGGCCTGGTGGGAGATGCTGGGG + Intronic
1067137753 10:43626309-43626331 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1067217723 10:44316669-44316691 AGGGTTGGTGGGAGGGTCTGGGG - Intergenic
1067217744 10:44316726-44316748 AGGGCTGGTGGGAGGGGCAGAGG - Intergenic
1067217761 10:44316764-44316786 GAGGGTGGTGGGAGGGGCTGAGG - Intergenic
1067217769 10:44316783-44316805 GAGGGTGGTGGGAGGGGCTGAGG - Intergenic
1067217777 10:44316802-44316824 AGGGCTGGTGGGAGGGGCTGAGG - Intergenic
1067306765 10:45071617-45071639 GAGCCTGTTGGGTGGCACTGGGG - Intergenic
1067342630 10:45417937-45417959 GGGCAGGGTGGGCGGCACTGGGG - Intronic
1067572475 10:47381526-47381548 GAGGCTGGCTGGTGGCACTGGGG + Intronic
1067591785 10:47519072-47519094 GGGCCTAGTGGGAGGCATTTGGG + Intronic
1067789483 10:49277041-49277063 GGGTCTGGTGGGAGGAAAGGTGG - Intergenic
1067827719 10:49591490-49591512 TGGGCTGCTGCGAGGCAGTGAGG + Intergenic
1067829841 10:49605249-49605271 GGGAAGGGTGGGAGGCATTGTGG + Intergenic
1069150543 10:64954080-64954102 AGGGCTGTTGGGGGGCACTGTGG - Intergenic
1069325252 10:67225021-67225043 GGGGCTGTTTGGGGGCACGGTGG + Intronic
1069359950 10:67630627-67630649 GGGACAGGTGGGAGACACTATGG + Intronic
1069748641 10:70731949-70731971 GGGACTGGAGGGAGGCATTGTGG + Intronic
1069893302 10:71665325-71665347 AGGGGTAGTGGGAGGCAGTGGGG - Intronic
1070284160 10:75071440-75071462 GGGGCTTAGGGGAGGCCCTGAGG - Intergenic
1070330715 10:75415162-75415184 AGAGCTGGTAGGAGTCACTGCGG - Intergenic
1070930592 10:80257874-80257896 GGGACAGGAGGGAGGAACTGTGG - Intergenic
1071015896 10:80996974-80996996 AGTGCTGTTGGGAGGCACGGTGG - Intergenic
1071365219 10:84892519-84892541 GGGCCTGGTGGGAGGTACTTGGG - Intergenic
1071481368 10:86067577-86067599 GGGGAAGGTGACAGGCACTGCGG + Intronic
1071518660 10:86315593-86315615 GTGGCTGGAAGGAGGCATTGTGG - Intronic
1071690808 10:87818019-87818041 GGCGCTTGGGGGCGGCACTGAGG + Exonic
1071713605 10:88073785-88073807 GGGGAAGGTGGGGGGCACTGCGG - Intergenic
1072019169 10:91381553-91381575 GGGGCTGGTGGGGGGTGGTGGGG - Intergenic
1072211466 10:93250400-93250422 GGGGCTGTTGGGAAGCTCAGGGG - Intergenic
1072721210 10:97782071-97782093 AGGGCTGGTGGGGGGCCCAGTGG + Intergenic
1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073430848 10:103485873-103485895 GTGGCTGGAGGGAGGAACTGGGG + Intergenic
1073452954 10:103620223-103620245 CGGGCTTCTGGGAAGCACTGGGG + Intronic
1073530991 10:104232030-104232052 GAGGCTGAGGGAAGGCACTGGGG + Intronic
1074100266 10:110349137-110349159 GGGCCTGGTGGGAGGTATTTAGG - Intergenic
1074101562 10:110358254-110358276 GGGGCTGGAGAGGGGCACAGGGG - Intergenic
1074369325 10:112886876-112886898 GGGGCTGGTGAGATGCAAGGCGG - Intergenic
1074373881 10:112923008-112923030 GGGGATTGTGGGAGGCACTGTGG - Intergenic
1074734003 10:116409019-116409041 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
1074781165 10:116803364-116803386 GGGGCTGGCAAGAGACACTGTGG + Intergenic
1074868412 10:117558377-117558399 GTGGATGATGGGAGGCACTTGGG + Intergenic
1075197695 10:120375278-120375300 GGGGCTGGGGGCAGGGTCTGTGG + Intergenic
1075378170 10:121996455-121996477 GGGCCTGGTGGGAGGTCATGGGG - Intronic
1075576140 10:123578890-123578912 GGGCCTGGTGGGAGGCGATTGGG + Intergenic
1075782092 10:125023614-125023636 GGGGCTGGTGGGCCGCACTGGGG + Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076362650 10:129900403-129900425 GGGGCTGGAGAGAGGCACACGGG + Intronic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076599092 10:131645695-131645717 GGGGCTGGGGGGATGGACTCTGG - Intergenic
1076671438 10:132122843-132122865 GGTTGTGGTGGGTGGCACTGGGG + Intronic
1076691086 10:132224208-132224230 CGAGCTGGTGGCAGGCTCTGTGG - Intronic
1076707682 10:132310539-132310561 GGGGATGCTGGGAGGGACTGAGG + Intronic
1076830590 10:132992391-132992413 GGTGCTGGTGGGATGCAGAGGGG + Intergenic
1076871275 10:133196229-133196251 GGGGCTGGTGGGATCCTCAGAGG - Intronic
1076995896 11:297382-297404 GAGGCTGCGGGGAGGCCCTGGGG - Intergenic
1077020718 11:416093-416115 GGGGCTGGTACCAGGCTCTGTGG - Intronic
1077032828 11:477404-477426 GGGCCTGGGGGGTGGCCCTGGGG + Intronic
1077098805 11:811987-812009 GGGGTTGGGGGCAGGGACTGAGG + Intronic
1077191830 11:1258913-1258935 GGGGTGGGAGGGTGGCACTGAGG - Intronic
1077243919 11:1526753-1526775 GGGGCTGGTGGGTAGCTGTGTGG - Intergenic
1077249262 11:1553768-1553790 GGGACTGGTGGGTAACACTGAGG + Intergenic
1077285527 11:1763688-1763710 GGGGCTCGTGGGGGCCACAGGGG + Intronic
1077287182 11:1772891-1772913 GGGGCTGGTGGGGGGAAAGGTGG + Intergenic
1077358813 11:2130771-2130793 GGGGTGGGTGGGGGGCAGTGGGG - Intronic
1077370449 11:2179385-2179407 GAGGATGGTGGGAGGCACTGGGG + Intergenic
1077392947 11:2308375-2308397 GGGGGTGGGGGCAGTCACTGCGG - Intronic
1077405033 11:2379001-2379023 GACGCTGGTGGGAGTCACTGTGG + Intronic
1077455268 11:2674432-2674454 GAGGCTGGGGGGAGGCACGTGGG + Intronic
1077587437 11:3464523-3464545 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1078266412 11:9758788-9758810 GGGACTGGCGGGAGGCCGTGTGG - Intergenic
1078439682 11:11353870-11353892 GGGGTTGGTGGGAGGCAATGTGG + Intronic
1078576602 11:12508167-12508189 GGGGCTGGGTGGAGGAACTGAGG - Intronic
1078728510 11:13954734-13954756 GGAACTGGAGGAAGGCACTGAGG - Intergenic
1079063119 11:17266942-17266964 GGAGCTGGTGGGTGGGAGTGGGG + Intronic
1079075993 11:17385984-17386006 CAGGATGGTGGGAGGGACTGAGG - Exonic
1080112051 11:28579474-28579496 GGGGCAAGAGGGAGGCACAGTGG - Intergenic
1080320057 11:30998004-30998026 GGGGGTGGGGGCAGGCACAGTGG + Intronic
1080428301 11:32175875-32175897 GGGGCTGGGGGTAGGGACTGTGG - Intergenic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1080698651 11:34625024-34625046 GGGGGTGGTGGGAGTACCTGGGG + Intronic
1081404682 11:42683345-42683367 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1081617251 11:44598168-44598190 GATTCTGGTGGGAGACACTGGGG + Intronic
1081932094 11:46878725-46878747 GGGCCTGGGGAGAGGCCCTGGGG - Intronic
1082095438 11:48125972-48125994 GTGGCAGGTGGGAGGCTCTCGGG + Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082862228 11:57867665-57867687 GGGCCTGGTGGGAGGTATTTGGG - Intergenic
1082935921 11:58656588-58656610 GGGGCTGGAGGGAGGGAATGCGG - Intronic
1083148786 11:60777076-60777098 GGGGTTGGTGGGAAGCACTTAGG - Intergenic
1083286352 11:61661654-61661676 GGGTCTGGTGGGAGGTGCTTGGG - Intergenic
1083387110 11:62319530-62319552 GGTGGTGGTGGGAGGAAATGGGG - Intergenic
1083742313 11:64717419-64717441 GGGCAGGGTGGGAGGCACTAGGG - Intronic
1083764227 11:64834404-64834426 GAGGCTAGGGGCAGGCACTGGGG - Intronic
1084149818 11:67282849-67282871 GGGGCTGGGGGGAGCTCCTGTGG + Intronic
1084153627 11:67302532-67302554 GGCGCTGTGGAGAGGCACTGTGG + Intergenic
1084176419 11:67424627-67424649 AGTGCTGGGTGGAGGCACTGTGG + Exonic
1084184546 11:67464750-67464772 GGGGCTGTGGGGCGGCACTGGGG - Intronic
1084226030 11:67715377-67715399 GGGGCAGGTGTGGGGCTCTGTGG - Intergenic
1084263861 11:67995251-67995273 GGGGCAGGTGTGGGGCTCTGTGG - Intronic
1084318861 11:68362249-68362271 GGGGCTGGGGGCGGGGACTGGGG + Intronic
1084331586 11:68433596-68433618 GGAGCAGGTGGGCGGCTCTGGGG - Exonic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1084392845 11:68890160-68890182 GGGGGTGGTGGGAGGGACCTGGG - Intergenic
1084432703 11:69120366-69120388 GGGGCTGGTGTGAGGAGGTGGGG + Intergenic
1084453015 11:69251184-69251206 AGGGCAGGTGGGAGGCGGTGGGG + Intergenic
1084596751 11:70121089-70121111 GAAGGTGGTGGGAGCCACTGAGG + Intronic
1084795441 11:71501892-71501914 GGGGCAGGGGCGTGGCACTGTGG + Intronic
1084829555 11:71758420-71758442 GAGGCTGGTGATAGGCACAGAGG + Intergenic
1085061618 11:73452542-73452564 GGGGTGAGTGGGAGGCACTTGGG + Intronic
1085253779 11:75160499-75160521 GCGGCTGGTGAGAGGAGCTGAGG + Intronic
1085543907 11:77299180-77299202 GGGGCTGGTGAGAAGCTGTGGGG - Intronic
1085626556 11:78078397-78078419 GGGGCTAGTGGGAGCTAATGGGG - Intronic
1085645238 11:78218395-78218417 GGGGCTGGCGGGGGCCTCTGAGG + Exonic
1085739517 11:79067006-79067028 GGGTGTGGAAGGAGGCACTGAGG - Intronic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1086729178 11:90227235-90227257 GGGCCTGGTGGGAGGTATTTGGG - Intergenic
1087069320 11:94061308-94061330 GTGGCTGATGGGTGGCACTGTGG + Intronic
1087302832 11:96455924-96455946 GGGCCTGGTGGGAGGTATTTGGG + Intronic
1087572596 11:99948899-99948921 GGGGCAGGTGGAATGCAATGAGG - Intronic
1088458504 11:110058438-110058460 GGGGCTGGATGTAGGCACAGGGG - Intergenic
1088750694 11:112839879-112839901 GGGGCTGCTGGGGGGAGCTGGGG + Intergenic
1088812490 11:113400949-113400971 GGAGATGGAGGGAGGCACAGCGG + Intergenic
1088897770 11:114091086-114091108 GGGTGCGGTGGGAGGCACTTCGG + Intronic
1089005650 11:115088549-115088571 GGGGACTGTAGGAGGCACTGGGG + Intergenic
1089291913 11:117442785-117442807 GGGGGTGGTAGGAGGTGCTGAGG + Intronic
1089299663 11:117490920-117490942 GGGGCTGGAGGCAGGATCTGGGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089536756 11:119165328-119165350 GGGACTGGTGGGAGGAACATGGG - Intergenic
1089603018 11:119626691-119626713 GCGGCTGGTGGGAAGAACTGAGG + Intronic
1089603799 11:119630086-119630108 GTGGCTGGTGGGAAGAACTGGGG + Intronic
1089821231 11:121228080-121228102 GGGCCTGGTGGGAGGCATTTGGG - Intergenic
1090075153 11:123576027-123576049 GGAGCTGGGGGCAGGCAGTGCGG - Intronic
1090195631 11:124814275-124814297 TGGGGTGGTGGGAGGAAATGGGG - Intergenic
1090405329 11:126473044-126473066 GGGGCTGGGGAGAGGGGCTGGGG - Intronic
1090415068 11:126534983-126535005 GTGGCTGGTGGGAGGAAGTGTGG + Intronic
1090429386 11:126633398-126633420 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1090594922 11:128310801-128310823 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1091142680 11:133249426-133249448 GGGCCTGGTTGGAGGCATTTGGG - Intronic
1091290129 11:134434846-134434868 GGGGCGGGGGGCAGGCACCGTGG + Intergenic
1091297216 11:134482334-134482356 TGGGTGGGTGGGGGGCACTGAGG + Intergenic
1091374071 12:14902-14924 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1091561667 12:1619103-1619125 GGGCTTGGTGGGAGGGGCTGGGG - Intronic
1091691031 12:2597693-2597715 GTGGCTGGAGGGAGGAGCTGTGG - Intronic
1092019079 12:5185520-5185542 GGGGGGCCTGGGAGGCACTGAGG - Intergenic
1094826769 12:34275519-34275541 TGTGCTGGTGGGGGGCACTGTGG - Intergenic
1095807376 12:46334884-46334906 GGGGGTGGTGGGGGGAATTGCGG - Intergenic
1095983452 12:47985387-47985409 GGGGTAGATGGTAGGCACTGGGG - Intronic
1096221002 12:49828140-49828162 GCGGCTGGAGGGAGGGACGGAGG + Intronic
1096496847 12:52043638-52043660 GGGGATGGGGGGAGCCACTTTGG - Intronic
1096526403 12:52212746-52212768 GGGGAGGGTGAGAAGCACTGGGG - Intergenic
1096788351 12:54030441-54030463 GGGACTGCGGGGAGGCCCTGGGG - Exonic
1097140824 12:56901261-56901283 GGGACTGGAAGGAGGCCCTGGGG + Intergenic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1099797077 12:87412580-87412602 GGGCCTGGTGGTGGGCACAGTGG - Intergenic
1100167258 12:91929867-91929889 TGGGATGGGGGGAGGCAGTGGGG + Intergenic
1100663112 12:96722122-96722144 GTGGTTGGTGGGTGGCACTGAGG - Intronic
1100685893 12:96985719-96985741 GGGGCAGGTGCGCGGCCCTGGGG + Intergenic
1101320119 12:103666077-103666099 GGGGCTGGTGGGAGGAGTTTAGG - Intronic
1101553326 12:105783866-105783888 GGTGCTGGCAGGAGGGACTGAGG + Intergenic
1101599910 12:106200284-106200306 GGGGTAGGTAGGAGGAACTGGGG - Intergenic
1101991127 12:109486087-109486109 AGAGCTTGTGGGAGACACTGCGG - Intronic
1102130956 12:110528442-110528464 GAAGATGGTGGGCGGCACTGCGG - Intronic
1102679912 12:114684406-114684428 AGGGCGGGCGGGAGCCACTGGGG + Intergenic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103023251 12:117553675-117553697 GGGCCTAGTGGGAGGTACTTGGG + Intronic
1103410854 12:120710528-120710550 GGGGCTGGTGGCTGGCAAGGAGG + Exonic
1103457838 12:121080130-121080152 GGGGCTGGTGGTGGCCACTCAGG - Intergenic
1103521898 12:121541642-121541664 GGGGGTGGCAGGAGGAACTGGGG - Intronic
1103552614 12:121747859-121747881 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552628 12:121747901-121747923 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552642 12:121747943-121747965 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552656 12:121747985-121748007 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552670 12:121748027-121748049 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552684 12:121748069-121748091 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552712 12:121748151-121748173 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103738396 12:123075503-123075525 GGGCGTGGTGGGAAGCCCTGTGG - Intronic
1103929790 12:124443996-124444018 AGGGCTGGTGTGAGGCAATAGGG - Intronic
1103948382 12:124539400-124539422 GGAGCTGGTGGGATGCTGTGCGG - Intronic
1103954597 12:124569005-124569027 GGGGCTGGCGGGAGCCTCTGGGG + Intergenic
1104363213 12:128153387-128153409 GGGCCTGGTGGGAGGTCCTTTGG - Intergenic
1104624227 12:130338803-130338825 GGGGCCGGGGGGAAGCGCTGAGG + Intronic
1104710144 12:130979971-130979993 GGGCCTGGCTGGAGGCTCTGTGG - Intronic
1104866814 12:131960894-131960916 GGGGCTGGGGAGCGGCAGTGGGG - Exonic
1104885364 12:132104262-132104284 GGGGCTGGGGAGCGGCAGTGGGG - Intronic
1104969599 12:132525247-132525269 GGGGACAGTGGGTGGCACTGAGG + Intronic
1104971475 12:132532771-132532793 GGGGCCGGTGAGAGGCCCTGAGG + Intronic
1104971749 12:132533955-132533977 GAGGCGGGTGGGTGCCACTGTGG + Intronic
1105296611 13:19092051-19092073 GGAGCTTGAGGAAGGCACTGTGG - Intergenic
1105386257 13:19932275-19932297 GGGGCTTTTGGGAGGTAATGAGG + Intergenic
1105446593 13:20462249-20462271 TGGCCTGGTGGGAGGCCCTGGGG + Intronic
1105519082 13:21115468-21115490 GGGGCTGGGGGGAGGGACATGGG + Intergenic
1105578764 13:21675034-21675056 GGGGCTGGGGGGAGGGGCTAGGG + Intronic
1105636482 13:22220533-22220555 GGGGCTGCAGGGAGGGGCTGGGG - Intergenic
1105859007 13:24393295-24393317 GGGGCTGCAGAGAGGCACTCGGG - Intergenic
1106308264 13:28532402-28532424 GGGGCTGGGCGGGTGCACTGGGG - Intergenic
1106473218 13:30076324-30076346 TGGGTGGGTGGCAGGCACTGAGG + Intergenic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1106588810 13:31080459-31080481 GGGGCTGGAGGGAGGGAGTCTGG + Intergenic
1107468084 13:40666789-40666811 TGGGCTGGTGGGGGGTAGTGGGG + Intergenic
1107738983 13:43428790-43428812 GAGGCGGGTGGGGGGTACTGTGG + Intronic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1108739654 13:53322609-53322631 GGGCCTGGTGGGTAGCACTTAGG + Intergenic
1108813513 13:54261992-54262014 GGGCCTGGTGAGAGACACTAGGG + Intergenic
1109330867 13:60927999-60928021 GCCTCTGGTGGGAGGCAATGTGG + Intergenic
1110572917 13:77026477-77026499 GGGGCTGGTGACAGGCACCATGG - Intronic
1110994447 13:82087975-82087997 GGGCCTGGTGGGAGGTATTTGGG - Intergenic
1111283000 13:86051520-86051542 GGGGCTTGTTGCAGCCACTGTGG - Intergenic
1112449848 13:99498655-99498677 GGGTCTGGTGGGAGGGGCCGGGG - Intergenic
1112928988 13:104712615-104712637 GGGCCTGGTGGGAGGTATTTTGG - Intergenic
1112953919 13:105036409-105036431 GGAGCGGGTGGGAAGCAATGTGG - Intergenic
1113365893 13:109675563-109675585 AGGGTTGGGGGGAGGCACTGGGG + Intergenic
1113615271 13:111676114-111676136 GGGCCTGGTGGGAGGTGATGGGG - Intergenic
1113620738 13:111761027-111761049 GGGCCTGGTGGGAGGTGATGGGG - Intergenic
1113777222 13:112954666-112954688 GGGGCAGGTTAGAGCCACTGGGG - Intronic
1113786881 13:113006677-113006699 GGGGCTGGCGGGAGACACTAAGG + Intronic
1113893720 13:113749745-113749767 GGGGCTGGAGGGAGGCACACGGG - Intergenic
1113917855 13:113884833-113884855 GGCTCTGTCGGGAGGCACTGGGG + Intergenic
1113941906 13:114022863-114022885 GGGGCTGGTGTGAGTCCCTGGGG + Intronic
1114069069 14:19094059-19094081 GGGGGTGGTGGCGGGCACTGGGG + Intergenic
1114069113 14:19094214-19094236 GGGGCAGGCGGCAGGCAGTGGGG + Intergenic
1114082328 14:19211668-19211690 GGGTCTGGTGGGAGGTGATGGGG + Intergenic
1114093147 14:19305789-19305811 GGGGCAGGCGGCAGGCAGTGGGG - Intergenic
1114093191 14:19305944-19305966 GGGGGTGGTGGCGGGCACTGGGG - Intergenic
1114183943 14:20386213-20386235 GGGACGTGTGGGAGTCACTGGGG + Intronic
1114267277 14:21080416-21080438 TGGGCTGATGGGAAGCACTGAGG - Intronic
1114458523 14:22872439-22872461 GGGGCTGGCGGCAGGGGCTGGGG - Intronic
1114616163 14:24069477-24069499 GGGGCTGGCAGGGGGCCCTGGGG - Exonic
1114989937 14:28273808-28273830 GGGCCTGGTGGGAGGCCATGGGG - Intergenic
1114998122 14:28385735-28385757 GGGGATGCTGGGAGGGGCTGAGG - Intergenic
1115120089 14:29927914-29927936 GGAGCTGGGGGCGGGCACTGGGG + Intronic
1115597631 14:34924460-34924482 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1116919667 14:50560108-50560130 GGCGCTGGTGGGAAGGAGTGGGG - Exonic
1117279201 14:54220619-54220641 GGGGCTGGAGGGAGGGGGTGGGG + Intergenic
1117369373 14:55062817-55062839 TGGTCCGGTGGGAGGCACGGAGG - Exonic
1117581993 14:57160686-57160708 AGGCATGGGGGGAGGCACTGTGG + Intergenic
1117696595 14:58370747-58370769 GGGTGTGGTGGCAGGCACTGTGG - Intronic
1117736136 14:58770702-58770724 GGAGGTGGTGGGAGGTGCTGGGG - Intergenic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118325762 14:64779345-64779367 TGGGGTGTTGGGAGGAACTGGGG - Intronic
1118750812 14:68806869-68806891 GGGACTGGTGGGAGGGAGGGTGG + Intergenic
1119188836 14:72664617-72664639 GGGGCAGGTGGGAGGTGGTGAGG - Intronic
1119447990 14:74682647-74682669 GGGCCTGGTGGGAGGTGATGGGG + Intronic
1119451017 14:74710942-74710964 TGGGCTGGTGCCAGGCACGGTGG + Intronic
1119478946 14:74947950-74947972 GGTGCTGGTCAGAGGCTCTGTGG + Intronic
1119480872 14:74956824-74956846 GGGGCTGGTGGGTGGCTGTGGGG + Intergenic
1119633695 14:76256834-76256856 GAGGCTGATGGGAGGCTTTGAGG - Intergenic
1119738738 14:77000251-77000273 GGGCCAGGAGGGAGGCACAGGGG + Intergenic
1119901686 14:78265954-78265976 AGGGATGGTGCTAGGCACTGGGG - Intronic
1119999452 14:79285858-79285880 GGGGATGGTGGGGGGCGGTGGGG - Intronic
1120326816 14:83039968-83039990 GGGGCTGGTGGGAGGTGATTGGG - Intergenic
1121224573 14:92311890-92311912 TGGGCTGTTGGGAGGTGCTGGGG + Intergenic
1121238515 14:92411317-92411339 GGGGTGGGTGGGAGGATCTGGGG - Intronic
1121307824 14:92917971-92917993 GGGGAGGGTGTGAGGCATTGGGG - Intergenic
1121799310 14:96760520-96760542 AGGCATGGTGGTAGGCACTGGGG - Intergenic
1122023523 14:98858646-98858668 GGGGATGCTGGGAGGTGCTGGGG - Intergenic
1122075875 14:99234142-99234164 GGGGCTGGGGGGAGCCAGTAGGG + Intronic
1122150616 14:99724303-99724325 GGGGCTGGGAGCAGGGACTGGGG - Intronic
1122306699 14:100771008-100771030 AGGTTTGGTGGGAGGCAGTGAGG + Intergenic
1122443827 14:101754686-101754708 GGGGCTGGAGAGGGGCAATGAGG + Intergenic
1122507001 14:102238100-102238122 GGGGTTGGTGAGAGGCTCGGAGG - Intronic
1122779171 14:104136417-104136439 GGCGGTGGCGGGAGGCACTAGGG + Intergenic
1122793356 14:104193646-104193668 GGGGCTGGGTGGAGGCACTGAGG - Intergenic
1122822651 14:104354992-104355014 GGGGCTGGGGGCAGGGGCTGGGG + Intergenic
1122930502 14:104931204-104931226 GGAGGTGGTGGGAGGACCTGGGG + Intronic
1122969735 14:105147678-105147700 GGGGCTGGCAGAAGGGACTGGGG + Intronic
1123042747 14:105497039-105497061 GGGGCTGGTGTGGGGGACAGCGG + Intronic
1123707166 15:22959004-22959026 GGGACTGGTGGATGGCACAGCGG - Intronic
1123976110 15:25555965-25555987 TGGTCTGGCGGGAGGCTCTGTGG + Intergenic
1124106745 15:26745183-26745205 GGGCCTGGTGGGAGGCGTTTGGG - Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1125349556 15:38752977-38752999 GGGTCTGATGGGAGGCATTTGGG + Intergenic
1125520330 15:40344796-40344818 GGGACTTGGGGGAGGCCCTGTGG - Intergenic
1125537708 15:40452073-40452095 GGGTCTGGTGGCAGGGGCTGAGG - Intronic
1126666939 15:51083819-51083841 GGGGCTGGGCGGAGCCAGTGAGG + Intronic
1127834181 15:62776862-62776884 GGGGCTGGTTGGGGGCATGGTGG + Exonic
1128060423 15:64732095-64732117 GGGGCTGGGGGGAGGGGCAGGGG - Intergenic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128220909 15:65967903-65967925 GGGGCTGGGGACAGGCTCTGGGG - Intronic
1128335137 15:66780936-66780958 TGGGGAGGTGGGAGGCACCGAGG - Intronic
1128529576 15:68434795-68434817 GGGACTGGTGGGAAGGAATGGGG - Intergenic
1128780807 15:70357511-70357533 GGGACTGAGGGGAGGCACTGGGG + Intergenic
1129107236 15:73318785-73318807 GGGGCTGTGGGGAAGCAGTGGGG - Intergenic
1129226698 15:74174448-74174470 GGCTCCGGTGGGAGGGACTGCGG + Intronic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129314654 15:74734152-74734174 GGGGCTGGTGGGAGGTGATTGGG + Intergenic
1129409280 15:75339926-75339948 TGGGCAGGTGGGAGGCAGTCAGG - Intronic
1129501784 15:76045793-76045815 GGGGCTGGTTGGGGGAAGTGGGG + Intronic
1129684600 15:77677883-77677905 GGGCATGGTGGGTGCCACTGAGG - Intronic
1129686349 15:77688219-77688241 TGGGCTGTTGGGAGGCTCGGGGG - Intronic
1129692174 15:77720120-77720142 GGGGCTGGTGGTAGGAGCAGGGG - Intronic
1130295741 15:82646490-82646512 GGGCCTGGCGGGAGGCACCCCGG + Intronic
1130537522 15:84798001-84798023 TGGGGTGCTGGGTGGCACTGTGG - Exonic
1130752260 15:86724690-86724712 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
1130987271 15:88852746-88852768 GGGAGTGGGGGGAGGCTCTGTGG - Intronic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1131154358 15:90065547-90065569 GAGGCTGGTGGGAGGAGCAGGGG + Intronic
1131811584 15:96179154-96179176 GGGGCTGAGTGGAGGCAATGAGG + Intergenic
1131838087 15:96409880-96409902 GGGGCTGGTGGGCGGCGCGGCGG - Intergenic
1132452527 15:101976153-101976175 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1132483385 16:177441-177463 GGGGCTGGGGGGAGGCCCAAGGG - Exonic
1132498040 16:273107-273129 GGGGCTGTGGGGAGGCCCGGTGG - Intronic
1132588793 16:717406-717428 GGGGCTGGTAGGAGGGAGGGTGG + Exonic
1132606788 16:796987-797009 GGGTCTGCTGGGGGGCATTGGGG + Exonic
1132608753 16:804706-804728 GAGGGTGGTGGGAGGCCTTGAGG + Intergenic
1132658098 16:1049629-1049651 GGGGCCGCTGGGAGACACTGTGG + Intergenic
1132660118 16:1057599-1057621 GGGCTTGGTGGGCGGCTCTGAGG - Intergenic
1132691067 16:1182187-1182209 GTGGCAGGTGGGAGGCTCTGCGG + Intronic
1132691516 16:1183720-1183742 GAGGCTGGGGGGCGGCCCTGGGG + Intronic
1132748863 16:1448162-1448184 GAGGCTGGTGGGGGGGGCTGCGG - Intronic
1132855441 16:2042768-2042790 GGGTGGGGAGGGAGGCACTGGGG - Intronic
1133188672 16:4117215-4117237 GTGACTGGCAGGAGGCACTGTGG - Intergenic
1133234569 16:4381944-4381966 GGGCCTCGTGGTGGGCACTGTGG - Exonic
1133273691 16:4624472-4624494 GGGGCAAGTGGAAGGCGCTGGGG + Intronic
1133300245 16:4778036-4778058 GGGGCTGGCGAGGGGCCCTGGGG - Intronic
1133354850 16:5128462-5128484 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1133454813 16:5932831-5932853 GTGGCGGGTGTGAGGCACTGGGG - Intergenic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134247105 16:12548188-12548210 TGGCCTTGTGGGAGGCGCTGTGG - Intronic
1134532862 16:14998399-14998421 AGGGCAGGTAGGTGGCACTGAGG + Exonic
1134687680 16:16169988-16170010 GCTTCTGGTGGGAGGCACAGCGG - Intronic
1135601154 16:23784716-23784738 GGTGCAGGTGGGAGGCTCAGAGG + Intergenic
1135663524 16:24316675-24316697 GGGTCTGGTCAGAGGCCCTGAGG - Intronic
1135885052 16:26298168-26298190 GGGCCTAGTGGGAGGCATTTGGG - Intergenic
1135921452 16:26652556-26652578 GGGCCTGGTGGGAGGTGATGAGG - Intergenic
1136075612 16:27815208-27815230 GGGCCTGGTGGGAGGTATTTTGG + Intronic
1136117417 16:28103576-28103598 AGGGCTGGTGAAAGGCACTTTGG - Intronic
1136138902 16:28276244-28276266 GGGGCTGGCGGGATGGAATGCGG + Intergenic
1136260234 16:29069913-29069935 GGGCCTGGTGGCTGGCTCTGAGG - Intergenic
1136282338 16:29221112-29221134 GGGGCGGCTGGGAGGCCCTGGGG + Intergenic
1136762027 16:32741463-32741485 GGGGTTGGCGGGAGGCACAAGGG + Intergenic
1136806073 16:33128925-33128947 GGGGTTGGCGGGAGGCACAAGGG - Intergenic
1137382161 16:48009488-48009510 AGGGATGATGGGAGGAACTGGGG + Intergenic
1137627114 16:49916194-49916216 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
1137708081 16:50548855-50548877 GGGGCCGGTGGCCGGAACTGGGG - Intronic
1137725860 16:50656149-50656171 GGACCTGGTGGGAGGCATTTGGG + Intergenic
1137761914 16:50948014-50948036 GGTGCTGGTGGCTGGGACTGTGG - Intergenic
1137843879 16:51668019-51668041 GGGGCTGGGAGGAGCCAGTGAGG + Intergenic
1138133570 16:54502240-54502262 AGGCCTGGTGGGAGGCATTCGGG - Intergenic
1138292082 16:55856406-55856428 GGGACTTGTTGGAGCCACTGAGG + Exonic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138485918 16:57343511-57343533 GGGACTTTTGGGTGGCACTGAGG + Intergenic
1138613563 16:58146472-58146494 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1138657933 16:58501406-58501428 GGCGCAGGCGGGAAGCACTGCGG - Intronic
1139280186 16:65763940-65763962 AGAGCTGGTGGGAGGCGCAGAGG + Intergenic
1139356022 16:66367425-66367447 GGTGCTGGTGGGAGGAATGGTGG - Intronic
1139569918 16:67805490-67805512 GGGGTGGGTGGCACGCACTGAGG + Exonic
1139717029 16:68821929-68821951 TGGTCTGGTGGAAGGCAATGGGG + Intronic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1139863176 16:70042335-70042357 AGGGCAGGTAGGTGGCACTGAGG - Intergenic
1139954316 16:70685988-70686010 GGGGCTGGCGGGCGGCGCGGGGG + Exonic
1140467160 16:75191702-75191724 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
1140517404 16:75553970-75553992 GGGGATGGTGGGAGGAATTGGGG - Intronic
1140884227 16:79228891-79228913 GTTGCTGGAGGGAGGAACTGGGG - Intergenic
1140915349 16:79488358-79488380 GGTGCAGGTAGGAGGCTCTGGGG + Intergenic
1140949274 16:79800590-79800612 GGGGCTGCTAGGAGCCACTGTGG - Intergenic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141123807 16:81385631-81385653 TGGGGTGGTGGGAGGCCCTGTGG + Exonic
1141300019 16:82806022-82806044 ATGGCAGGTGGGAGGCACTCTGG + Intronic
1141712965 16:85710613-85710635 GGGGCTGGTGGCCGGGAATGAGG - Intronic
1141895087 16:86954076-86954098 GGGGCTGGGGGGAGGGCCGGCGG + Intergenic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142121557 16:88388964-88388986 AGGGCTGGTGTAAGGCACAGAGG - Intergenic
1142167632 16:88601129-88601151 GGGGCAGGTGTGGGCCACTGGGG - Intronic
1142175486 16:88643248-88643270 GGGGCCGGTGGGCGGGGCTGGGG - Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142228682 16:88889333-88889355 GGGGGTGGTGGGAGGGAGGGAGG + Intronic
1142287344 16:89176866-89176888 GGGACGGGTGGGAGGTGCTGGGG - Intronic
1142291091 16:89193864-89193886 GGGGCTGGTGGGCAGCACTCGGG - Exonic
1142312360 16:89321385-89321407 GGGGCTGCAGGGCGGGACTGTGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356235 16:89603493-89603515 GGGGCTGGAGGGGGGCACTGGGG + Intergenic
1142356243 16:89603513-89603535 GGGGCTGGAGGGGAGCCCTGGGG + Intergenic
1142356262 16:89603554-89603576 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356296 16:89603636-89603658 GGGGCTGGAGGGGAGCCCTGGGG + Intergenic
1142356315 16:89603677-89603699 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356360 16:89603777-89603799 GAGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356392 16:89603875-89603897 GGGGCTGGAGGGAAGCAGTGGGG + Intergenic
1142356398 16:89603895-89603917 GGGGTTGGAGGGGAGCACTGAGG + Intergenic
1142356412 16:89603935-89603957 GGGGCTGGCAGGAAGCACTGGGG + Intergenic
1142356420 16:89603955-89603977 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356428 16:89603975-89603997 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356444 16:89604015-89604037 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356459 16:89604057-89604079 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356483 16:89604118-89604140 GGGGCTGGAGGGGAGCCCTGGGG + Intergenic
1142356492 16:89604138-89604160 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356507 16:89604180-89604202 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356526 16:89604221-89604243 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356546 16:89604262-89604284 GGGGCTGGAGGGGGTCACTGGGG + Intergenic
1142356554 16:89604282-89604304 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356580 16:89604362-89604384 GGCGCTGGAGGGGAGCACTGGGG + Intergenic
1142356586 16:89604382-89604404 GGGGTTGGAGGGGAGCACTGAGG + Intergenic
1142356626 16:89604505-89604527 GGGACTGGAGGGGAGCACTGGGG + Intergenic
1142356633 16:89604525-89604547 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356646 16:89604565-89604587 AGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356661 16:89604605-89604627 GGGGCTGGAGGGGAGCACTGGGG + Intergenic
1142356667 16:89604625-89604647 GGGGCTGGAGGGGAGCATTGAGG + Intergenic
1142368647 16:89665133-89665155 GGGGGTGGTGGCGTGCACTGTGG - Intronic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142504990 17:357677-357699 GGGGCTGGTGCGGGGTCCTGAGG + Intronic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142894347 17:2964340-2964362 GGGGGTGGGGGGAGGGGCTGGGG + Intronic
1142919312 17:3170410-3170432 GGGCCTGGTGGGAGGTGCTTGGG + Intergenic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143032624 17:3976383-3976405 GGGGCTGGGGGGTGGGGCTGCGG + Intergenic
1143452181 17:7042780-7042802 GGGGATGGGGGCCGGCACTGGGG + Intronic
1143524551 17:7464470-7464492 GGGGCTGGAGGGAGGCAGACCGG + Intronic
1143568445 17:7739540-7739562 GGGGCTGCTGGGATGAACTTTGG - Intronic
1143763053 17:9118633-9118655 GGGGTGGGTGGGAGGAAATGGGG - Intronic
1143780237 17:9225454-9225476 GGGGCTGGCGGGGGGCCCTGAGG + Intronic
1143781812 17:9233115-9233137 GAAGCTGCTGGGAGCCACTGGGG + Intronic
1143901937 17:10181049-10181071 GGGGGTGGGGGGTGGCAGTGCGG + Intronic
1144278822 17:13703662-13703684 AGGGGTGGTGCTAGGCACTGGGG + Intergenic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1144783406 17:17819018-17819040 GGATCTGGTGGTGGGCACTGAGG - Exonic
1144788296 17:17843926-17843948 AGGGCTGGTGACGGGCACTGGGG + Intronic
1144816985 17:18041188-18041210 GGGGCGGGGGGGAGGCAGTGGGG - Intronic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146375753 17:32293161-32293183 GGGGCTGGAGGGAGGGGGTGGGG + Intronic
1146545733 17:33736470-33736492 TAGGCTGGCGGGAGACACTGAGG - Intronic
1146798518 17:35800074-35800096 GGGAGTGCTGGGAGGCACTGTGG - Intronic
1146878931 17:36432203-36432225 GGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146882871 17:36453349-36453371 GGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1146911235 17:36649752-36649774 AGAGGTGGTGGGGGGCACTGAGG + Intergenic
1146923698 17:36730084-36730106 GGGGCTGGTGGCAGGGCCTTGGG - Intergenic
1147140947 17:38460444-38460466 GTGGCGGGTAGAAGGCACTGTGG - Intronic
1147322171 17:39653095-39653117 GGGGGTGGTGGCAGGCCCAGAGG + Intronic
1147330479 17:39696302-39696324 GGGGATGGGGGGAGGAGCTGGGG - Intronic
1147375104 17:40018546-40018568 AGGGGAGGTGGGAGGGACTGAGG - Intergenic
1147466588 17:40615625-40615647 GGGGCTGGAGGGAAGGGCTGAGG + Intergenic
1147614078 17:41818283-41818305 GGGGCTGGAGGGGAGCCCTGAGG + Intronic
1148127198 17:45242959-45242981 GGCCCTGATGGGAGGCACAGGGG - Intronic
1148142547 17:45338733-45338755 GGGGCTGGGAGGAAGCAGTGAGG + Intergenic
1148201666 17:45753619-45753641 GGGGCCTGTGGGAGGTTCTGAGG - Intergenic
1148394028 17:47294392-47294414 TGGTCTGGTGTGAGGCACTGCGG + Intronic
1148755577 17:49971461-49971483 GGGCCTGGAGGGAGGCCTTGGGG + Intronic
1148774856 17:50089594-50089616 GGCTCTGGTGGGAGGCTCTTTGG - Exonic
1148851333 17:50556914-50556936 TGGGCTGGTGGCTTGCACTGAGG - Intergenic
1148875374 17:50683951-50683973 GGGGATCGTGGGCCGCACTGGGG + Exonic
1149072492 17:52559164-52559186 GGGCCTGGTGGGAGGCACATTGG + Intergenic
1149439202 17:56661345-56661367 TGGGGAGGTGGGAGGCAGTGAGG - Intergenic
1149496509 17:57121770-57121792 GGGGCAGGGGCGGGGCACTGGGG - Intergenic
1149523440 17:57335886-57335908 GGGGCTAGTGGAAGGAGCTGAGG + Intronic
1149636021 17:58170081-58170103 GGGGCTGGTGGTAGCCACCTGGG + Exonic
1149985858 17:61346466-61346488 GGGGCTGTTGTGAGGCTCTGTGG + Intronic
1150208743 17:63429514-63429536 GGGCGTGGTGGCATGCACTGTGG - Intergenic
1150216800 17:63475902-63475924 GGGGCTGTTGGGAATCACTTGGG - Intergenic
1150653836 17:67026917-67026939 GGAGCAGGTGGCGGGCACTGGGG - Intronic
1151248802 17:72817480-72817502 GGGCCTGGTGGGAGGTGCTTGGG - Intronic
1151341197 17:73472045-73472067 GTGGCTGGTGGGTGCCACTCTGG + Intronic
1151471769 17:74322809-74322831 GGGGCTGGGGCCAGGCACGGTGG + Intergenic
1151556048 17:74847265-74847287 GGGGGTGGGGGGGGGCACTGAGG - Intronic
1151979158 17:77498710-77498732 TGGGGTGGTGGGAGGGCCTGGGG - Exonic
1152157179 17:78642100-78642122 GGGGCTTGTGAGAGTCACAGAGG + Intergenic
1152189426 17:78879488-78879510 GGGCCTGGTGTTAGGCACTGGGG + Intronic
1152212121 17:79008277-79008299 GGGGCTGCAGGGAGGGTCTGTGG + Intronic
1152273451 17:79339511-79339533 GGAGCTGGTGGGAGGGAAGGAGG + Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152550590 17:81028070-81028092 GGTGCCTGTGGGAGGCAGTGCGG - Intergenic
1152585980 17:81189677-81189699 GGGGCAGGTGGGCGTCCCTGTGG + Exonic
1152617963 17:81346371-81346393 GTGGCTGGCGGGAGGGGCTGCGG + Intergenic
1152630500 17:81408739-81408761 GGGGCTGCTGCCAGGCTCTGTGG - Intronic
1152654332 17:81512971-81512993 GGGGCCGTTGGGAGGCGGTGCGG - Intronic
1152662929 17:81551339-81551361 GGGGAAGGTGGGAGGCCATGTGG - Intronic
1152685414 17:81691406-81691428 GGGCCTGGTCACAGGCACTGGGG - Intronic
1152750250 17:82059262-82059284 TGGCCTGGTGGGGGGCAGTGTGG + Intronic
1152760146 17:82103466-82103488 GGGGGTGGGGGGAGGGAGTGGGG - Intronic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152892307 17:82889400-82889422 GGTGCTGCTGGGAGGCTCAGTGG + Intronic
1152895373 17:82907874-82907896 GGGGAGGGTGGGAGGCCCTAAGG - Intronic
1152915920 17:83035825-83035847 CGGGCTGGTGGAGGTCACTGAGG + Intronic
1153284710 18:3447614-3447636 TTGGCTGGGGGGAGGCAGTGGGG + Intronic
1153657673 18:7299379-7299401 GGGTCTGGTGGGAGGTATTTGGG + Intergenic
1154420051 18:14221914-14221936 GAGGCTGGCAGGTGGCACTGTGG + Intergenic
1154499193 18:14986565-14986587 GGGTCTGGTGGGAGGTGCTTTGG - Intergenic
1155964909 18:32026603-32026625 GGGGGTGCTGGGAGGGTCTGGGG - Intronic
1156378260 18:36533632-36533654 TGGGCAGGTGGGTGGAACTGCGG + Intronic
1156454705 18:37286483-37286505 GGCGATGGCGGGAGGCACCGAGG - Intronic
1156467073 18:37354383-37354405 GGGACTGGTGGGGGGCGCAGAGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157506408 18:48229824-48229846 GGGGCAGGTGTGGGGCACTGAGG + Intronic
1158422546 18:57308401-57308423 AGGGCTGGTGGGGGGAATTGGGG + Intergenic
1158855867 18:61542952-61542974 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1159344345 18:67179953-67179975 TGGGCTGGTGGAAACCACTGTGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160673382 19:376844-376866 GAGGCTGGGTGGAGGCACGGGGG - Intergenic
1160798067 19:954818-954840 GGGGCTGATGGGGGGCGGTGGGG + Intronic
1160893669 19:1392907-1392929 GGGGCTGGGTGTTGGCACTGTGG + Intronic
1161268308 19:3375358-3375380 GGGGGTGGTGGGGGGCACAGTGG - Intronic
1161293346 19:3507153-3507175 GGGGCTGGTAGGGGGCACGCTGG - Intronic
1161297426 19:3526908-3526930 TGGGCTGCTGGGGGGCTCTGAGG + Intronic
1161374768 19:3933710-3933732 GGACCTGGTGGGCGGCCCTGCGG + Intronic
1161453116 19:4357592-4357614 GGGGCTGTTGGGAGAGCCTGGGG + Intronic
1161614142 19:5260716-5260738 GGGCCTGGGGGCAGGCCCTGTGG + Intronic
1161672428 19:5621809-5621831 CCGGCAGGTGGCAGGCACTGAGG - Intronic
1161714438 19:5867317-5867339 GGGGCGGGAGGTTGGCACTGGGG + Exonic
1162196654 19:8990057-8990079 GGGGCTGGGGAGGGGCAATGGGG - Intergenic
1162506627 19:11089763-11089785 GGCGCTGGAGGGGGGCGCTGAGG + Intronic
1162706409 19:12558324-12558346 GGGGCTGGGGCCAGGCACGGTGG + Intronic
1162782724 19:13014874-13014896 GGGGCTGGTGGTAGGCGAGGTGG + Intronic
1162987005 19:14277350-14277372 GGGGCTGGAGGGAAGCACGTGGG + Intergenic
1163433581 19:17282365-17282387 AGGGCTCGAGGGAGGCGCTGGGG + Intronic
1163481549 19:17559515-17559537 TGGGCTGGAGGCAGGGACTGAGG - Intronic
1163484016 19:17575921-17575943 GGTACTGGTGGTTGGCACTGGGG + Intronic
1163520033 19:17786651-17786673 GGGCTGGGTGGGAGGGACTGGGG + Intronic
1163576663 19:18114903-18114925 TGGGCAGGTGGGAAGCGCTGGGG + Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1163814321 19:19454721-19454743 GGGGGTGGGGGGGGGCACAGTGG - Intronic
1164580260 19:29430351-29430373 AGGCCTGGTGGGAGGCGCTTGGG + Intergenic
1164676011 19:30102070-30102092 GGGCCTGGTGGGAGGCTTTTGGG - Intergenic
1165042756 19:33080845-33080867 GGGGCTGGCGCGAGGGACGGGGG + Intergenic
1165068008 19:33240263-33240285 GGGGCTGAGGGAGGGCACTGGGG + Intergenic
1165335558 19:35167337-35167359 GGGGCTGCTGGCAGGAGCTGTGG + Intronic
1165485369 19:36092424-36092446 GGGGCTGTGGGGAAGAACTGGGG - Intronic
1165718642 19:38063343-38063365 GGGGATGGGGGGCGGCAGTGGGG - Intronic
1165830980 19:38730022-38730044 GGGGCTGGTGGGATGGGGTGCGG - Exonic
1166343406 19:42151450-42151472 GGGGCTGGGGGGACGCACCTGGG + Intronic
1166837587 19:45677050-45677072 GGTGCTCGTGGGAGGCTCCGAGG + Exonic
1167072784 19:47230571-47230593 GGGGCGGGGGGGCGGCACGGAGG - Intronic
1167171618 19:47836180-47836202 TGGGCTGGTGTGAGGCCCTGAGG - Intronic
1167253863 19:48415656-48415678 GGGGCTGGGAGGAGGGACTTTGG + Intronic
1167284019 19:48588764-48588786 GGTGATGGTGGGAGCCACAGAGG + Intronic
1167368171 19:49065369-49065391 GGAGGTGGTGGGGGGAACTGTGG - Intergenic
1167698243 19:51027255-51027277 GGGGCTGCTGCCAGGCACAGGGG + Intronic
1167786731 19:51643709-51643731 CAGGTTGGTGGGAGGGACTGAGG - Intronic
1167980821 19:53273263-53273285 TGGGGTCGTGGAAGGCACTGGGG + Intergenic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168524577 19:57078728-57078750 AGGGCTGTTGGGAGGATCTGAGG - Intergenic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
1168642749 19:58040767-58040789 GGGGCTGGGGTGAGGCCCAGAGG - Intronic
1168693512 19:58392032-58392054 CGGGGTGGTGCCAGGCACTGTGG + Intronic
925201271 2:1969222-1969244 CGGGCAGGTGGGAGGAGCTGTGG + Intronic
925221783 2:2147655-2147677 GGGGCGGGTGGGTGGCTCAGAGG + Intronic
925327490 2:3035014-3035036 GGGGCTGGGAAGAGACACTGAGG - Intergenic
925327510 2:3035106-3035128 GGGGTTGGGAGGAGACACTGAGG - Intergenic
925342699 2:3148111-3148133 GGAGCTGCTGGGTGGCCCTGTGG - Intergenic
925356884 2:3248037-3248059 GGGCCTGGTGGGAGGTATTGGGG + Intronic
925519483 2:4726022-4726044 GAGGTTGGTGGGAGGGACTGGGG + Intergenic
925929257 2:8694094-8694116 GGGGCTGATGGGGGGCGGTGGGG + Intergenic
926911952 2:17859617-17859639 GGCACTGGTGGCAGGAACTGAGG - Intergenic
927192964 2:20529527-20529549 AGTGCTGCTGGGAGCCACTGAGG + Intergenic
927195170 2:20541903-20541925 GGGAGTGGTGGGAAGAACTGAGG + Intergenic
927343537 2:22010017-22010039 GGGCCTGGTGGGAGGCATTTAGG + Intergenic
927913966 2:26922298-26922320 TGGGCTGGGGGCAGGCACAGAGG + Intronic
930027108 2:47035743-47035765 GGGGCTGGAGGCAGGAATTGTGG + Intronic
930118465 2:47740196-47740218 GGGCCTGGTGGGAGGCATTTGGG - Intronic
931253061 2:60550561-60550583 GGGGCGGGGGGGTGGTACTGAGG + Intronic
931373821 2:61689203-61689225 GGTGGTGGTGGGTGGCACTGGGG + Intergenic
931439318 2:62276831-62276853 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
931633953 2:64325537-64325559 GGAGCTGGTAGAAGGGACTGAGG + Intergenic
931648946 2:64451830-64451852 GGGGCTGGGGGCAGTGACTGAGG - Intergenic
931704453 2:64935814-64935836 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
931720144 2:65061623-65061645 AGGGCTGGTGTGGGGGACTGTGG + Intronic
932144709 2:69307126-69307148 GTGGCAGGTAGGAGGCGCTGCGG + Intergenic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932490563 2:72117367-72117389 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
932557331 2:72836119-72836141 GGGGCAGGTAGAAGGCATTGGGG - Intergenic
933401476 2:81803004-81803026 GGGGCTGGGGGAAGGGAATGAGG - Intergenic
933454869 2:82507981-82508003 GGGGGTGGGGGGTGGCATTGAGG + Intergenic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
934539639 2:95163150-95163172 GGGCCTGGTGGGAGGTATTTGGG - Intronic
934557375 2:95294590-95294612 GGGGCTGTGGGGAGAAACTGAGG - Intergenic
934566221 2:95343047-95343069 GGAGGTGGGGAGAGGCACTGGGG + Intronic
934639689 2:96020250-96020272 GTGGGTGCTGTGAGGCACTGGGG - Intergenic
934650082 2:96085648-96085670 GGGGCTGCTGAGAGGCCCTGGGG + Intergenic
934723102 2:96595615-96595637 GGTGCTGGAGGCAGGCGCTGTGG + Exonic
934793957 2:97085127-97085149 GTGGGTGCTGTGAGGCACTGGGG + Intronic
934924752 2:98374488-98374510 GTGGCTGGTGGAAGGGCCTGGGG - Intronic
934988592 2:98904855-98904877 GGGCCTGGTGGGAAGCACTCCGG + Intronic
935028105 2:99296614-99296636 GGGCTTGGTGGGAGGCGCTTTGG - Intronic
935131594 2:100265012-100265034 GGGCCTGGTGGCACACACTGTGG - Intergenic
935221720 2:101021057-101021079 GGGGAGGCTGGTAGGCACTGAGG - Intronic
935791971 2:106601204-106601226 GGGCCTGGTGGGAGGTGCTTGGG - Intergenic
936397858 2:112142564-112142586 GGGTCAGGTGGGAGGCACTGAGG + Intronic
936568739 2:113598627-113598649 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
937297553 2:120818684-120818706 GGGCCTGGGCGGAGACACTGGGG - Intronic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938292616 2:130158168-130158190 GGAGCAGGTGGGAGGAATTGGGG - Intronic
938364480 2:130724011-130724033 GGGCCTGGTGGGAGGTAATTGGG + Intergenic
938494258 2:131784935-131784957 GGGTCTGGTGGGAGGTGATGGGG - Intergenic
938498405 2:131816933-131816955 GGGTCTGGTGGGAGGTGCTTTGG - Intergenic
938562792 2:132489418-132489440 GGGGCTGGCGGCAGGCCGTGGGG + Intronic
938823712 2:134983611-134983633 AGGGGTGGAGGGAGGGACTGTGG + Intronic
939985966 2:148830150-148830172 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
940374842 2:152946200-152946222 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
941527799 2:166628332-166628354 TGGGATGGTGGGCTGCACTGTGG + Intergenic
941627406 2:167844891-167844913 GGGGCTGTTAGGGGGCACAGTGG + Intergenic
941771283 2:169348798-169348820 GGCGGGAGTGGGAGGCACTGGGG + Intronic
941779896 2:169432531-169432553 GGGGCTGGTGGGAGTCTCATAGG - Intergenic
942181066 2:173381285-173381307 TGGGGTGGTGGCATGCACTGTGG - Intergenic
942265870 2:174225051-174225073 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
942364718 2:175212770-175212792 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
942871151 2:180735973-180735995 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
943268648 2:185770587-185770609 GGGCCTGGTGGGAGGTGCTTTGG - Intronic
943405470 2:187477925-187477947 GAGGCTGGCAGGAGGCAATGTGG + Intronic
943846563 2:192656216-192656238 GGGGCAGGTGGGAGACTCTCTGG + Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945041473 2:205746620-205746642 GGAGTTTGTGGGAGCCACTGGGG + Intronic
947163210 2:227235128-227235150 GGGGGTGGGAGGGGGCACTGAGG + Intronic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947636561 2:231683384-231683406 GAGCCAGTTGGGAGGCACTGGGG + Intergenic
948128198 2:235580439-235580461 GGTGCTTGTTGGAGGCAGTGGGG + Intronic
948691911 2:239711544-239711566 GGGGGTGATGGGATCCACTGTGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
949035989 2:241815977-241815999 GGGGCTGGAGGAAGGCACAGGGG - Intronic
1168830793 20:844331-844353 GGGGCTGTTGAGAGGACCTGAGG + Intronic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1169765127 20:9140545-9140567 GGGCCTGGTGGGAGGTATTTGGG + Intronic
1170816656 20:19720100-19720122 AGGTCTGCTGGGTGGCACTGGGG - Intronic
1171011961 20:21513759-21513781 GGAGTTGGGGGGAGGGACTGGGG + Exonic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1171195193 20:23191691-23191713 AGGGCTGGTGGTGGTCACTGAGG - Intergenic
1171232665 20:23500173-23500195 GGGCCTGGTGGGAGGTGCTTGGG - Intergenic
1171401772 20:24877815-24877837 GTGGCTGGAGGGAGGAAGTGTGG + Intergenic
1171462734 20:25308143-25308165 TTGCCTGGTGGGAGGCGCTGTGG - Intronic
1171823195 20:29874214-29874236 GGGGCGGTTGGGAAGCACGGAGG - Intergenic
1171887679 20:30671214-30671236 GGGGCTGGTGGGAGATTCTCTGG - Intergenic
1172270812 20:33654807-33654829 GGGGCTGGGGCGAGGCACAATGG + Intergenic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172505026 20:35455254-35455276 GGGGCAGGTGGGAGGTGCTCGGG + Intronic
1172697945 20:36835303-36835325 GGGGTTGGGGGGGGGCACTGAGG + Intronic
1172764081 20:37341810-37341832 GGAGGTGGTGGGAGCCACGGAGG - Intergenic
1172767359 20:37357963-37357985 GGGGTTGGTGGAGGCCACTGAGG + Intronic
1172989734 20:39025434-39025456 TGGGCTGGTGCGAGGCAGTGTGG + Intronic
1173479924 20:43390440-43390462 GGGGGCGGTGGGGGGCGCTGGGG + Intergenic
1173616496 20:44406631-44406653 GGGGTTGGTGGAAGCCCCTGGGG - Intronic
1173940781 20:46909351-46909373 GGTGCAGGTGGGAGGCAGTAAGG + Intronic
1174137084 20:48387117-48387139 GTGGCTGGTGGGTGGCACTTGGG - Intergenic
1174148412 20:48468634-48468656 GGAGCAGGTGCCAGGCACTGTGG + Intergenic
1174200903 20:48805694-48805716 GTGGCTGTTGGGGGGCACAGAGG - Intronic
1174289876 20:49500492-49500514 GGAGCAGGAGGGAGGCAGTGTGG - Intergenic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1175018803 20:55822296-55822318 GGGGCTGGGAGTAGGCATTGTGG + Intergenic
1175268926 20:57720162-57720184 TGGGCTGGTGGGGGGCAGTGCGG + Intergenic
1175343954 20:58256817-58256839 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1175375215 20:58519436-58519458 GGGACTAGTGGGAGGCACCCAGG - Intergenic
1175592603 20:60204880-60204902 ATGGCTGGTGTGAGGAACTGGGG + Intergenic
1175778706 20:61668881-61668903 GGTGCTGGTGGAAGGCACCCGGG - Intronic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175863493 20:62162714-62162736 GGGAGTGGTGTCAGGCACTGGGG - Intronic
1175883188 20:62272217-62272239 GGGGCTGGCAGGAGGCCCTGTGG - Exonic
1175988142 20:62774519-62774541 TGGGCTGGCGGGAGGCATGGAGG + Intergenic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176711524 21:10154444-10154466 GGGTCTGGTGGGAGGTGATGCGG - Intergenic
1178003754 21:28193285-28193307 GTTCTTGGTGGGAGGCACTGAGG - Intergenic
1178205106 21:30455914-30455936 GGGCCTGGTGGGAGGTGTTGAGG - Intergenic
1178576098 21:33792972-33792994 GGGTCTGGGGGGAGGTACTTAGG - Intronic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1178958115 21:37041649-37041671 GGGGATGGTGGGTGGCAGTGAGG - Intergenic
1179046412 21:37849077-37849099 GAGACTGCAGGGAGGCACTGAGG + Intronic
1179261122 21:39758728-39758750 AGGGGTGCTGGGAGGAACTGGGG + Intronic
1179454644 21:41490782-41490804 GGGGCTGCTGGGCATCACTGGGG - Intronic
1179489308 21:41729930-41729952 GTGGGTGGTGGGAGGCGATGGGG - Intergenic
1179591121 21:42409242-42409264 CCTACTGGTGGGAGGCACTGCGG - Intronic
1179638894 21:42733902-42733924 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1179727296 21:43347637-43347659 CGGGCTGGGGGCCGGCACTGTGG - Intergenic
1179787844 21:43739987-43740009 GGGGCAGGTGGTATCCACTGCGG - Intronic
1179794751 21:43776375-43776397 GGGGCGGGGAGGAGGCACTTTGG + Exonic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1180198983 21:46213579-46213601 AGGGCTTGTGGAAGCCACTGAGG - Intronic
1180487542 22:15816621-15816643 GGGGGTGGTGGCGGGCACTGGGG + Intergenic
1180487587 22:15816777-15816799 GGGGCAGGCGGCAGGCAGTGGGG + Intergenic
1180498448 22:15911002-15911024 GGGTCTGGTGGGAGGTGATGGGG - Intergenic
1180499551 22:15920130-15920152 GGGTCTGGTGGGAGGTGCTTTGG - Intergenic
1180742169 22:18061316-18061338 GGGCAGGGTGGGAGGCACTGAGG + Intergenic
1181034968 22:20165485-20165507 GGGGCTGGGCGGGGGCCCTGTGG + Intergenic
1181053011 22:20246517-20246539 GGTGGCGGTGGGAGGCTCTGGGG + Intronic
1181343520 22:22200895-22200917 GGTGCTGGGAGGAGACACTGAGG - Intergenic
1181479111 22:23186546-23186568 GGGGCTGGGGGCAGGGAATGGGG - Intronic
1181484643 22:23223097-23223119 GGGGCTGCTGGGAGGTGATGAGG - Intronic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181776784 22:25165862-25165884 GGAGCCAGTGGGAGGGACTGGGG + Intronic
1181801522 22:25350795-25350817 GGGGCTGAAGGGAGTCACGGTGG - Intergenic
1181813815 22:25421510-25421532 AGGGCGGGTGGGGGGCACTCCGG + Intergenic
1182424437 22:30264651-30264673 GGGGCTGGTGGGATGCCCGTGGG + Intronic
1182475030 22:30572658-30572680 GGTGATGGTGGGAGGAAGTGGGG - Intronic
1182546561 22:31080177-31080199 GGGGCTGGGGGGTGTCACAGAGG + Intronic
1182619324 22:31610167-31610189 GGGACTGGGAGGAGGGACTGAGG + Intronic
1182775870 22:32830650-32830672 GGGGCGGGGGGGTGGCCCTGTGG - Intronic
1183086274 22:35489225-35489247 CGGGCTGCTGTGAGGCACTGAGG + Intergenic
1183197397 22:36362923-36362945 GGCACTGGTGGAAGGCATTGGGG - Intronic
1183282082 22:36937493-36937515 GGGGCTGGGGGGCTGCTCTGTGG - Exonic
1183288157 22:36980954-36980976 GGGCCTGGTGGGAGGCGTTTGGG - Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183429874 22:37759088-37759110 AGGGCTGGTGGAAGGCAGTGAGG - Intronic
1183807363 22:40222436-40222458 GGGGCTTGTGTGAGGAAATGGGG + Intronic
1184016468 22:41789635-41789657 GGGGCTGGGGGAGGGGACTGGGG - Intronic
1184222397 22:43109636-43109658 TGGGCTGTTGGGAGGAACAGAGG - Intergenic
1184236248 22:43184672-43184694 AGGGCTGGGGGGAGGCTCAGAGG + Intronic
1184241765 22:43214672-43214694 GGGGCAGTGGGGAGGGACTGGGG + Intronic
1184291651 22:43500669-43500691 GGGGCTGGTCCCAAGCACTGAGG - Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1184416669 22:44355872-44355894 GGGGCCGATGGGGGCCACTGTGG - Intergenic
1184487001 22:44785823-44785845 GGGGTTGAGGGCAGGCACTGGGG - Intronic
1184563142 22:45275007-45275029 GGGGCTGGTGCCAGGGAATGAGG + Intergenic
1184593733 22:45502499-45502521 CCGGCTGCTGGGGGGCACTGGGG - Intronic
1184671139 22:46012877-46012899 GGGACAGGAGGGAGGCCCTGAGG - Intergenic
1184684403 22:46089618-46089640 GGGGCTGCTGGCAGGCTCTTGGG + Intronic
1184717061 22:46288376-46288398 GGGCCTGGAGTGAGGCTCTGGGG - Intronic
1184751225 22:46487751-46487773 GGTGCAGGTGGGAGGTATTGGGG + Intronic
1184764489 22:46564430-46564452 GGGGCTGGTGGGCGGGGCAGTGG - Intergenic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1185066263 22:48633101-48633123 CGGGCTGCTGGGAGACCCTGTGG - Intronic
1185122350 22:48979464-48979486 TGGGCTGGTGTGTGGCTCTGTGG + Intergenic
1185274269 22:49943651-49943673 AGGGCTGGTGTGGGGCGCTGGGG - Intergenic
1185300540 22:50077633-50077655 GGGCCAGCTGTGAGGCACTGTGG + Intronic
949925492 3:9037812-9037834 GGGGCTGCTGTGTGGCAGTGGGG - Intronic
950138558 3:10600104-10600126 GGGGCTGGTGGGGGGCCATGGGG + Intronic
950557128 3:13702628-13702650 GGGGCAGGTGGAAGGGACTGAGG + Intergenic
950565505 3:13767428-13767450 GGGGCTGGGGTGGGACACTGGGG + Intergenic
950576871 3:13837334-13837356 GGGGCTGATGCGGGGCACTGTGG - Intronic
950611598 3:14130592-14130614 GGGGCTAGTGGGAACCAATGGGG + Intronic
950672448 3:14535378-14535400 TGGGTTGCTGGGAGGAACTGTGG + Intronic
950854190 3:16090068-16090090 GCTGCTGGTGGAAGGCTCTGAGG - Intergenic
952873872 3:37925457-37925479 GGGGCTTGTTGGAGGCTGTGGGG + Intronic
953387516 3:42514937-42514959 TGGGAAGGTGGGAGGCACTGAGG + Intronic
953439782 3:42907393-42907415 GTGGCTGGTGGCAGTGACTGGGG + Intronic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
953608700 3:44429264-44429286 GGGGCTGGTGGGAGTGGCTTGGG - Intergenic
953984520 3:47431104-47431126 GAAGCTGCTGGGAGGCACAGAGG + Intronic
954149104 3:48648396-48648418 GGGACTTGTGGGCGGCGCTGGGG - Exonic
954414464 3:50386327-50386349 TGGGCTGGGGGTTGGCACTGAGG - Intronic
954424086 3:50434274-50434296 GGGGCAGGGGGGCGGCACTGAGG - Intronic
955212380 3:56954302-56954324 GGGGTGGGGTGGAGGCACTGAGG - Intronic
955409346 3:58645798-58645820 GGGGGCTGTTGGAGGCACTGTGG - Intronic
955880142 3:63534919-63534941 GGGCCTGGTGGAAGGTGCTGGGG - Intronic
956607004 3:71083137-71083159 GGGCCTGGTGGGAGGTATTTGGG + Intronic
957079293 3:75623205-75623227 GGGGCAGGTGTGGGGCTCTGTGG - Intergenic
957555653 3:81761760-81761782 GGAGCGGGTAGGAGGCACCGAGG + Exonic
960516037 3:118603906-118603928 GGGGCTGGTGGGAGGTGTTAAGG + Intergenic
960595526 3:119404446-119404468 GGGGCTGCTGAGAGGCTCAGGGG + Intronic
961134358 3:124496258-124496280 GGGGGTGGGGGGAACCACTGTGG - Intronic
961699076 3:128727427-128727449 GGAGGTGGTGGGAGGCACTGAGG - Intronic
961891239 3:130131907-130131929 GAGGCTGGTGATAGGCACAGAGG - Intergenic
962932173 3:140048808-140048830 GGGCCTGGTGGGATCAACTGTGG - Intronic
963112617 3:141699730-141699752 GGGGTTGGTGAGAGGCTCGGAGG + Intergenic
963228628 3:142888485-142888507 GGGGCCAGAGGGAAGCACTGGGG - Intronic
964552819 3:157903917-157903939 GGGGCTTGTGGGAGGTATTTGGG + Intergenic
964572935 3:158130243-158130265 GGGTCTGGTGGGAGGTAATTAGG - Intronic
964623761 3:158739591-158739613 GTGGGAGGTGGGAGGCAGTGGGG + Intronic
964896448 3:161602386-161602408 GGGCCTGGTGGGAGGTAATTGGG - Intergenic
965816781 3:172644296-172644318 GGGGCTGCTCAGAGTCACTGAGG - Intronic
966412348 3:179656721-179656743 GGGTCTGGTGGAAGGCAATATGG - Intronic
966852745 3:184174839-184174861 GGGGCGGGGCGGCGGCACTGCGG + Exonic
966944150 3:184765890-184765912 GTGGCTGGTGGCAGGCTCAGAGG + Intergenic
967054335 3:185815753-185815775 GGTGCTGGTGGGAGGGAGAGAGG - Intronic
967227658 3:187307285-187307307 GGGGCTGGTAGGTGGGAGTGGGG - Intergenic
967647766 3:191947299-191947321 GGGGATGGAGGGAGGCATTCTGG + Intergenic
967751855 3:193124298-193124320 GGGGCAGTTGGGAGACACTTTGG + Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968200549 3:196751033-196751055 GGGGCTGGAGGTAGGGAATGAGG - Intronic
968449031 4:666512-666534 TAGGCTGGTGGGAGGAACAGAGG - Exonic
968489625 4:883080-883102 CTGGCTGGTGGGAAGCAGTGAGG + Intronic
968599802 4:1503591-1503613 GGGGCTGGGGGCAGCCGCTGAGG - Intergenic
968641439 4:1716931-1716953 GGGGCAGGAGGGAGGCAAAGAGG + Exonic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968808248 4:2788593-2788615 TGGGCTGGTGGCAGGCACTCTGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969002628 4:3994348-3994370 GAGGCTGGTGATAGGCACAGAGG - Intergenic
969022377 4:4147159-4147181 GGGGCAGGTGTGGGGCTCTGTGG - Intergenic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969263197 4:6046569-6046591 GGGGCAGGCGGGCGGCAGTGGGG + Intronic
969265618 4:6062332-6062354 GGAGCAGGTGGGAGGCACGCTGG - Exonic
969622000 4:8283367-8283389 GGGGATGGTGGCAGGGACCGGGG - Intronic
969663640 4:8544738-8544760 GGTGCTGCTTGGGGGCACTGAGG + Intergenic
969718848 4:8882051-8882073 GGCGCTGGTGGAAGGCCCAGGGG - Intergenic
969731494 4:8960233-8960255 GGGGCAGGTGTGGGGCTCTGTGG + Intergenic
969751392 4:9114180-9114202 GAGGCTGGTGATAGGCACAGAGG + Intergenic
969791097 4:9494341-9494363 GGGGCAGGTGTGGGGCTCTGTGG + Intergenic
969811300 4:9650464-9650486 GAGGCTGGTGATAGGCACAGAGG + Intergenic
969843566 4:9901666-9901688 GGGGCTGGTGGGGGGGCATGGGG - Intronic
970492184 4:16585561-16585583 GTGCCTGGGTGGAGGCACTGGGG + Intronic
970903696 4:21190501-21190523 GTGGGTGGGGGGGGGCACTGAGG + Intronic
971972085 4:33633885-33633907 GGGCCTGGTGGGAGGCCCCATGG + Intergenic
972299832 4:37774176-37774198 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
972437264 4:39045392-39045414 GGTGCTGGTGGCCGGCAGTGAGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
972615139 4:40690944-40690966 AGGGCAGCTGGGAGCCACTGGGG - Intergenic
972630187 4:40835750-40835772 GGGACTGCTGGGGGCCACTGCGG + Intronic
973532031 4:51843903-51843925 CGAGGTGGTGGGAGGGACTGGGG + Intronic
973633108 4:52838059-52838081 GGGGCTGCTGGGGAGCAATGGGG - Intergenic
973777221 4:54254777-54254799 AGGGCTGGTGTTAGGCACAGTGG - Intronic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974330990 4:60478896-60478918 GGGACTGGTGGGAGGTAATTGGG - Intergenic
975137309 4:70887490-70887512 GGGGCGGGGGGTAGGCATTGGGG - Intergenic
975448885 4:74501060-74501082 AGGGTTGATGGGGGGCACTGGGG + Intergenic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
975592237 4:76011601-76011623 GGGTCAGTTGGGAGTCACTGAGG + Intronic
975666894 4:76741521-76741543 CGGGCTGGAGGTAGGCACTCTGG - Exonic
975900124 4:79141413-79141435 GATGCTGGTGGGAGGCACTTGGG + Intergenic
976199027 4:82561580-82561602 CGGGCTGGCTGGCGGCACTGCGG + Intronic
977416112 4:96734303-96734325 GGGCCTGGTGGGAGGTAATTGGG + Intergenic
977872867 4:102113856-102113878 GGGGCTGCTGTGAGGCTCTTTGG - Intergenic
978141077 4:105318058-105318080 GGGCCTGGTGGGAGGCATTTGGG + Intergenic
978178047 4:105758353-105758375 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
978824561 4:113005750-113005772 GGGCCTAGTGGGAGGCATTTGGG + Intronic
978869259 4:113555838-113555860 GGGGCCTGTGGGAGGTAATGAGG + Intronic
979035603 4:115712758-115712780 GGGGCTGTTGGGAGGTAATCAGG + Intergenic
980035767 4:127881190-127881212 GGGGCGGGTGGGAGTAATTGTGG + Intronic
980728680 4:136799221-136799243 GGGCATAGTGGGAGGCACTTGGG - Intergenic
981805140 4:148706778-148706800 GGGCCTGGTGGGAGGCAATTGGG + Intergenic
981825473 4:148935782-148935804 GGGCCTGGTGGGAGGAGTTGTGG + Intergenic
982251696 4:153413712-153413734 GGGGAGGGTGGGAGGAACAGTGG - Intronic
982289247 4:153763517-153763539 AAGGCTGGAGGGAGCCACTGCGG - Intergenic
982598197 4:157412707-157412729 GGGGCTGGTGGGAGGTGTTTTGG - Intergenic
984116163 4:175683573-175683595 GGGCCTGATGGGAGGCATTTGGG + Intronic
984277517 4:177627739-177627761 GGGGCTGGAGGGTGGTGCTGAGG + Intergenic
984841289 4:184070074-184070096 GGGCCTGGTGGGAGGCAACTGGG + Intergenic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985357086 4:189132911-189132933 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
985507246 5:290375-290397 GGGGGTGGGGGGAGGCATTCCGG - Intronic
985698669 5:1357650-1357672 GGGATGGGTGGCAGGCACTGCGG + Intergenic
985746875 5:1652816-1652838 GGGGCAGGAGGGAGGGACTTAGG + Intergenic
985788623 5:1913180-1913202 GGGGGTGGCGGGAAGGACTGGGG + Intergenic
986119092 5:4814122-4814144 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
986255541 5:6100279-6100301 GGGGTGAGTGGGAGGCCCTGGGG - Intergenic
986307925 5:6529231-6529253 TGGTGTGGTGGGAGGCACAGGGG - Intergenic
986370632 5:7077203-7077225 AGGGGCGGTGGGAGCCACTGAGG - Intergenic
986506293 5:8455627-8455649 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
986608014 5:9542180-9542202 GTGGCTGCTGGGAAGCACTTTGG - Intronic
987023776 5:13902381-13902403 GAGCCTGGGGGGTGGCACTGGGG + Intronic
987075574 5:14379097-14379119 GGGTCTGGAGGGAAGCACAGGGG + Intronic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
987183237 5:15387789-15387811 GGGTCTGGTGGGAGGTTCTTGGG - Intergenic
987987047 5:25161323-25161345 GGGCCTCGTGGGAGTCTCTGGGG - Intergenic
988514840 5:31895290-31895312 GGGGCTTTTTGGAGGCACTTAGG + Intronic
988814160 5:34815643-34815665 GGGAGTGGTGGGAGGTATTGGGG + Intronic
989678151 5:43997194-43997216 GGGCCTGGTGGGAGGTGCTTGGG - Intergenic
990051511 5:51507172-51507194 GGGGCTGGGCGGGGGCAGTGGGG - Intergenic
990207640 5:53446839-53446861 GGGGCTGGGGGGAGGGGCGGCGG + Intergenic
990419909 5:55621127-55621149 GGGCCTGATGTGAGGCACAGGGG + Intergenic
990873040 5:60454638-60454660 GGGCATGTTGGGAGGCAGTGAGG + Intronic
990936231 5:61152873-61152895 AGTGCTGCTGGGAGCCACTGAGG - Exonic
991317596 5:65327009-65327031 GGGCCTGGTGGGAGGTATTTGGG + Intronic
991658271 5:68924795-68924817 GTGGCTGGAGGAAGGAACTGAGG + Intergenic
991911827 5:71570372-71570394 GGGGCAGATGGGAGCCTCTGAGG - Intergenic
992060716 5:73043965-73043987 GGGATTGGTGGGAGGCAATTGGG + Intronic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
993340774 5:86722750-86722772 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
994146494 5:96401383-96401405 GGGGCAGGGGAGAGGCAGTGAGG + Intronic
994197640 5:96936734-96936756 GGGTCAGGAGGGTGGCACTGTGG - Intronic
995034441 5:107516977-107516999 AGGGCTGGGGGTAGGCACAGGGG + Intronic
995244708 5:109922538-109922560 GGGGCTGGGGGGAGGCTGTGGGG + Intergenic
996930012 5:128874974-128874996 GGGCCTGGTGGGAGCCATTTTGG + Intronic
996993118 5:129660950-129660972 GAGGCTGTTGGGTGGCAGTGGGG - Intronic
997101665 5:130976037-130976059 GGAGCTGGTGTGAGTAACTGGGG - Intergenic
997791887 5:136769249-136769271 GGTGGTGGTGGGAGGCTCAGAGG + Intergenic
997926594 5:138035890-138035912 GGGGATGGTGGTAGTCTCTGAGG - Intronic
997940631 5:138154326-138154348 GGGGGTGGTGGGTGGCAATACGG - Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998329030 5:141307040-141307062 GGGGAGGGTGGGAGGGATTGAGG + Intergenic
998354113 5:141520377-141520399 GGGCCTAGTGGGAGGCACTTGGG + Intronic
998940835 5:147280437-147280459 GGGGGTGGTGGAAAGCACGGTGG + Intronic
999073897 5:148776974-148776996 GGCCCTGGTGTGAGTCACTGTGG - Intergenic
999125013 5:149240132-149240154 GGGGCTGGCAGGTGGCCCTGTGG + Intronic
999370091 5:151049634-151049656 GAGGCTGCTGGTAGTCACTGTGG - Intronic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
999888103 5:155946103-155946125 GTGGCTGGTGGTGGTCACTGGGG + Intronic
999900217 5:156079261-156079283 GGGCCTGGTGGGAGGGATTTGGG - Intronic
1000052693 5:157575896-157575918 GGGGCTGGAGGGAGGGGCCGGGG + Intergenic
1000112987 5:158126999-158127021 GGGGGTGGGGGCAGGAACTGGGG - Intergenic
1000269609 5:159671490-159671512 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1000599923 5:163260113-163260135 GGGCATGGTGGCACGCACTGAGG + Intergenic
1001093722 5:168760545-168760567 AGGGCTGGTGGGTGGGACTCAGG - Intronic
1001224322 5:169930742-169930764 GAGTCGGGTGGAAGGCACTGTGG + Intronic
1001269743 5:170302313-170302335 GGGGCTGGGGGAAGGGTCTGGGG + Intergenic
1001396501 5:171422185-171422207 GGAGCTGGAGGGAGGGAGTGTGG + Intronic
1002008582 5:176257608-176257630 GGGCCTGGTGGGAGGTATTTGGG - Intronic
1002257491 5:177968912-177968934 GGGGCTAGTGGGAGGTATTTGGG - Intergenic
1002303762 5:178271909-178271931 GGGGCCTATGAGAGGCACTGAGG - Intronic
1002358214 5:178648255-178648277 GGTGCTGGTGAGAGGCACAGGGG + Intergenic
1002453389 5:179331947-179331969 GGGGCTGCTGTGTGGGACTGAGG - Intronic
1002548072 5:179965296-179965318 GGTGCCAGCGGGAGGCACTGTGG + Intronic
1003032725 6:2616494-2616516 GGGCCTGGTGGGAGGGGCTTGGG + Intergenic
1003120930 6:3318569-3318591 GGGCCTCCTGGGAAGCACTGGGG - Intronic
1003127928 6:3370594-3370616 GAGTCAGGTGAGAGGCACTGAGG - Intronic
1003229193 6:4234959-4234981 GGGGCTGGTCGGGGGCTGTGGGG + Intergenic
1003338137 6:5194345-5194367 GGGGATGCTGGGAGGGACTGTGG - Intronic
1003572980 6:7268159-7268181 GGGGGTGGTGGGTGGGAGTGGGG - Intergenic
1003869651 6:10391366-10391388 GGGGCAGGTGGGACCCAGTGAGG + Intergenic
1004021187 6:11776842-11776864 GAGGCAGGAGGGAGCCACTGTGG + Intronic
1004160082 6:13205326-13205348 GGGCCTAGTGGGAGGCATTTGGG - Intronic
1004959578 6:20771646-20771668 GGGCCTGGTGGGAGGTATTTGGG + Intronic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006363830 6:33603083-33603105 GGGACTGGTGGGAGGTGCTTGGG - Intergenic
1006378407 6:33684301-33684323 GTAGCTGGAGGGAGGCAGTGTGG + Intronic
1006426136 6:33964011-33964033 GGGACAGGTGGGAGGAAGTGAGG + Intergenic
1006599695 6:35217233-35217255 GGGGCGGGGGGGAGGCGCGGCGG + Intronic
1006610608 6:35292279-35292301 GGGGCTGGTAGGGGGCACTGGGG - Intronic
1006620739 6:35362277-35362299 TGGCCTGGAGGGAGGCACTTGGG + Intronic
1006650306 6:35545552-35545574 GGTGGGGGTGGGAGGCACTAAGG + Intergenic
1007237767 6:40403354-40403376 GGAGCTGGTGGGATTCAGTGAGG + Intronic
1007244260 6:40448839-40448861 GAGGCTGGCTGGAGGCTCTGTGG + Intronic
1007679578 6:43625082-43625104 AGGGCTGGCAGGAGGCACTGAGG - Intronic
1008602879 6:53112811-53112833 GGTGGTGGTGGGAGGAGCTGGGG - Intergenic
1008645668 6:53511804-53511826 GGGGGTGGAGGGAGGAACTAAGG + Intronic
1008942728 6:57064657-57064679 GTGGATGGTGGGAGGCCCGGGGG + Intergenic
1009965211 6:70570585-70570607 GAGGGTGGTGGGGGGCACGGTGG - Intronic
1010304603 6:74304462-74304484 GGGGCTTGTTGGGGGCAGTGTGG + Intergenic
1011032162 6:82935352-82935374 GGGCCTGGTGGGAGGCTGTTTGG - Intronic
1012017804 6:93874221-93874243 GGGCCTGGTGGGAGGCGATTTGG + Intergenic
1012199134 6:96383843-96383865 GGGCGTGGTGGCAGGCACCGGGG - Intergenic
1012384259 6:98659812-98659834 GGGGCTGGTTGGGGGCAAAGGGG - Intergenic
1012551033 6:100464970-100464992 GGGGCTTGTGAGTGGCATTGAGG - Intergenic
1012930656 6:105312863-105312885 GGGGCTACGGGGCGGCACTGGGG + Intronic
1013177859 6:107692712-107692734 TGAGCTGGTGGGACTCACTGGGG - Intergenic
1013242779 6:108261175-108261197 GAGGCTGGGGAGGGGCACTGCGG + Exonic
1014807515 6:125846709-125846731 GGGGCTTCGGGGAGGCCCTGTGG + Intronic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1015444098 6:133283813-133283835 TGGGCAGGTGGGAGGGAGTGAGG - Intronic
1015863317 6:137702853-137702875 GGTGCTGGTGGCTTGCACTGAGG - Intergenic
1016631341 6:146236479-146236501 GTGACTGGTGGTAGGCACTAGGG + Intronic
1017252985 6:152301922-152301944 GGGGCTGGCGGAAGGGACAGAGG - Exonic
1017428662 6:154348222-154348244 GGGACTTGAGGGAGGGACTGTGG - Intronic
1017883597 6:158579908-158579930 GGGGCTGGGGGAAGGGAATGGGG + Intronic
1017969407 6:159298796-159298818 GGAGCGGGAGGGAGGCTCTGAGG - Intergenic
1018370683 6:163165332-163165354 GGGGCTGGTAGGGGGCGCTGAGG + Intronic
1018459162 6:163981108-163981130 GGGGCTATTGGGAAGTACTGAGG - Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG + Intergenic
1019441510 7:1049904-1049926 CTGGCTGGTGGGAGGCAATCAGG - Intronic
1019476005 7:1244608-1244630 GGGGCTGATGGGTGGCTCAGTGG + Intergenic
1019499612 7:1358449-1358471 GGGGTGGGTGGGAGGGGCTGGGG - Intergenic
1019514587 7:1434157-1434179 TGGGCTGGTGGGAGCCTCAGAGG - Intronic
1019561651 7:1662274-1662296 GGGGCTGGAGTGGGGCACTGAGG + Intergenic
1019730038 7:2624482-2624504 GGGCGTGGAGGGAGGCGCTGGGG - Intergenic
1019882196 7:3871759-3871781 GGGCCTGGTGGGTGGCGTTGGGG - Intronic
1019933117 7:4236637-4236659 GTGGCTGTTGGGAACCACTGAGG + Intronic
1020092583 7:5349886-5349908 GGGGGTGGAGGGGGGCACTGAGG + Intronic
1020104397 7:5415144-5415166 GGAGCTGGTGGGAGGGGATGTGG - Intronic
1020309802 7:6859202-6859224 GGGGCAGGTGTGGGGCTCTGTGG - Intergenic
1020321574 7:6942470-6942492 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1020787682 7:12591085-12591107 GGGGTTGGTGAGAGGCTCGGAGG + Intronic
1021438938 7:20655471-20655493 GGGGCTGGGGGGAGGTGCGGGGG - Intronic
1022060317 7:26786541-26786563 GGGGAAGGTGGGAGGGAGTGAGG + Intronic
1022228053 7:28383710-28383732 GGGCCTGGTGGGAGGCGATTGGG - Intronic
1022332889 7:29396975-29396997 GGTTCTGGTGGGAGGGACTGAGG - Intronic
1022465428 7:30650039-30650061 GAGGCTGGTGTGAGGACCTGTGG + Intergenic
1022638500 7:32159895-32159917 GGAGCTTGTGGGAGCCTCTGGGG - Intronic
1022804829 7:33811280-33811302 GGGCTTGGTGGAAGGGACTGGGG - Intergenic
1022924278 7:35044340-35044362 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924306 7:35044440-35044462 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924315 7:35044480-35044502 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924382 7:35044740-35044762 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924402 7:35044800-35044822 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924409 7:35044820-35044842 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924416 7:35044840-35044862 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924423 7:35044860-35044882 GGGAATGGTGAGAAGCACTGGGG - Intergenic
1022924440 7:35044920-35044942 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924447 7:35044940-35044962 GGGAATGGTGAGAAGCACTGGGG - Intergenic
1022924488 7:35045120-35045142 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924499 7:35045160-35045182 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1022924504 7:35045180-35045202 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924511 7:35045200-35045222 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924518 7:35045220-35045242 GGGAATGGTGAGAAGCACTGGGG - Intergenic
1022924522 7:35045240-35045262 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924550 7:35045360-35045382 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924557 7:35045380-35045402 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924564 7:35045400-35045422 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924571 7:35045420-35045442 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924578 7:35045440-35045462 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924585 7:35045460-35045482 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924592 7:35045480-35045502 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924599 7:35045500-35045522 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924606 7:35045520-35045542 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924613 7:35045540-35045562 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924620 7:35045560-35045582 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924627 7:35045580-35045602 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924655 7:35045680-35045702 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924679 7:35045760-35045782 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924750 7:35046040-35046062 GGGAATGGTGAGAAGCACTGGGG - Intergenic
1022924777 7:35046160-35046182 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924784 7:35046180-35046202 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1023030693 7:36088162-36088184 GGGCCTGGTGGGAGGCGTTTGGG + Intergenic
1023089879 7:36607887-36607909 GGGGCTCTTGAGAGGCACTGTGG + Intronic
1023109874 7:36798999-36799021 ATGGCTGGTGAGAGGCAGTGAGG + Intergenic
1023372646 7:39527506-39527528 GGGCCTGATGGGAGGTACTTGGG - Intergenic
1023512565 7:40968965-40968987 GGGGCTTCTGGGTGGGACTGTGG - Intergenic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024278378 7:47697663-47697685 GGGCCTGGTGGGAAGCATTTTGG - Intronic
1024659737 7:51482067-51482089 GGGGTTGGTGAGAGGTTCTGGGG - Intergenic
1025678555 7:63663517-63663539 GGGGTGGGGGGGCGGCACTGGGG + Intergenic
1025776769 7:64567933-64567955 GGAGGGGGTGGGAGGCCCTGGGG - Intergenic
1026158186 7:67845946-67845968 GTGGGTGGTGGGAGCCACTGGGG + Intergenic
1026185765 7:68081757-68081779 GGGCCTGGTGGGAGGTATTTAGG - Intergenic
1026234614 7:68515837-68515859 GGAGCTGGAGGGAGGGACAGTGG + Intergenic
1026451267 7:70531705-70531727 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1026509992 7:71019647-71019669 GGGCCTAGAGGGAGGCACAGTGG + Intergenic
1026621542 7:71953914-71953936 GGGGTTGGTGGTTGGCAGTGTGG + Intronic
1026671248 7:72392457-72392479 GGTGCTGATGGGAGAGACTGAGG + Intronic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026850704 7:73721560-73721582 GGGGGTGGTGGAGGGCACAGCGG - Intergenic
1026879511 7:73899878-73899900 GGCGCTGGCAGGAGGCACCGTGG - Intergenic
1026968110 7:74453267-74453289 GGGGCTGGTTGGGGGGACAGGGG + Intergenic
1027139652 7:75648150-75648172 GGGGCTGGTTGGAGTAGCTGAGG + Intronic
1027139672 7:75648265-75648287 GGGGCTGGTTGGAGTAGCTGGGG + Intronic
1027162599 7:75813544-75813566 GGGGCTGGAGGGAAGCGCTGGGG - Intronic
1027711051 7:81601763-81601785 GGGCCTAGTGGGAGGTACTGGGG + Intergenic
1028136728 7:87230445-87230467 GAGGCTGATGGGGGCCACTGAGG + Intergenic
1028899079 7:96075829-96075851 GGGGCTGGTGGCTGGGACCGGGG - Intronic
1029252276 7:99245297-99245319 GGAGCTGGTGGCAGGGACAGGGG + Intergenic
1029274544 7:99396497-99396519 GGGGATGGGGGGGGGGACTGGGG - Exonic
1029420542 7:100469662-100469684 GGGGCTGGAGGGCAGGACTGGGG - Intronic
1029536891 7:101162622-101162644 GGGGCTCGTGGGAGGCCCGAAGG + Exonic
1029822676 7:103160446-103160468 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1029822762 7:103160766-103160788 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1029974007 7:104815710-104815732 TGGGGTGGTGGTAGGCACAGGGG - Intronic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1030261347 7:107567795-107567817 GGGGCTGCTGTGAGGAACAGTGG - Intronic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1031523300 7:122793151-122793173 GGGGCTGGAGGGATGCACCAAGG - Intronic
1031721978 7:125187684-125187706 GGGCCTGGTGGGTGGAAGTGGGG + Intergenic
1031797613 7:126196019-126196041 GGGTATGGTGGGAGGTACTTGGG - Intergenic
1032018472 7:128393959-128393981 GTGGCTGGTGGCAGGGGCTGTGG - Intronic
1032194177 7:129780163-129780185 GCGGCTGGACGGAGGCCCTGCGG + Intergenic
1032282806 7:130518478-130518500 GGAGCAGGTGGGTGGCATTGAGG + Intronic
1033028399 7:137800325-137800347 GGGCCTGGTGGGAGGCGTTTGGG + Intronic
1033415999 7:141161639-141161661 GGAACAGGTGGGAGGCAGTGCGG + Intronic
1034230958 7:149528125-149528147 GGGGCTGGAAGGAGGTCCTGGGG + Intergenic
1034402057 7:150868847-150868869 GAAGCTGGTGGGAAGCACAGGGG - Intergenic
1034461456 7:151200015-151200037 GAGGCTTGTGGGGGGCAGTGTGG + Intronic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1035066521 7:156109232-156109254 AGGGAGGGTGGGAAGCACTGTGG - Intergenic
1035074436 7:156168955-156168977 GGGGGTGGTTGGGGGCAGTGGGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035374074 7:158395834-158395856 GGGGCTGGTGGGATCCAAGGCGG - Intronic
1035630689 8:1104683-1104705 TGGGCTGGTGGGCTGCACTGAGG + Intergenic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035680347 8:1483176-1483198 GTGGCTGATGAGAGGCCCTGAGG + Intergenic
1036021529 8:4852264-4852286 GGGCCTTGTGGGAGGTGCTGGGG + Intronic
1036374600 8:8189594-8189616 GAGGCTGGTGATAGGCACAGAGG + Intergenic
1036391557 8:8328345-8328367 GGGGCTGCTGGGGGCCACTGGGG + Exonic
1036632641 8:10526039-10526061 GGTGCTGATGGGAGCCACAGAGG - Intronic
1036644081 8:10601301-10601323 GGGGGTGGTGAGAGGCCCTTGGG + Intergenic
1036854942 8:12233553-12233575 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1036876301 8:12476041-12476063 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1037508096 8:19552900-19552922 GTGGCTGATGAGAGGCCCTGGGG + Intronic
1037839496 8:22233609-22233631 TGGGGTGGTGCGTGGCACTGAGG + Intergenic
1038176324 8:25184646-25184668 GCGGCCGGCGGGAGGGACTGGGG + Intergenic
1038293737 8:26272276-26272298 GGGGCTCTTGGGAAGCCCTGTGG - Intergenic
1038304779 8:26389562-26389584 TGGGATGGTGGTAGCCACTGGGG + Intronic
1038575553 8:28701313-28701335 GGGGATTGTGGGAGGCGCGGGGG - Exonic
1038789915 8:30658870-30658892 GGTGCTGGTGTGTGGCGCTGGGG - Intergenic
1039083713 8:33759186-33759208 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1039886073 8:41654420-41654442 TGGGCAGAGGGGAGGCACTGAGG + Intronic
1039888868 8:41671241-41671263 GGGGCTGGTGGGCTTAACTGGGG - Intronic
1040304919 8:46207020-46207042 TGGGCTGGTGGCAGGGACTCAGG + Intergenic
1040387239 8:46921734-46921756 AGGGCAGGTGAGAGGCCCTGGGG + Intergenic
1040516958 8:48143401-48143423 GGGCCTGGTGGGAGGCGTTCTGG + Intergenic
1040655501 8:49502895-49502917 GGAGCTGGTGGGAGGAAATTAGG + Intergenic
1041706002 8:60846905-60846927 GGGGCTGTGGTGAGGCTCTGAGG + Intronic
1041733637 8:61087574-61087596 GTGCCTGGTGGGAGGAAGTGAGG + Intronic
1041958374 8:63582744-63582766 GGGGTTTGGGGGAGGCACTGAGG + Intergenic
1042028168 8:64445885-64445907 GGGACAGGTGGGAGGAACTCAGG + Intergenic
1042098562 8:65246993-65247015 GGGGCTGGGGGGAGGTGCTTAGG + Intergenic
1042164637 8:65933746-65933768 AGGGATGTTGGGAGGCACTAGGG + Intergenic
1042878073 8:73457940-73457962 GGGGTTGGAGGAGGGCACTGAGG + Intronic
1043482012 8:80663508-80663530 AGGGTTGGTGGGGGGCACAGAGG + Intronic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1046546714 8:115661777-115661799 GGGGTTGGTGGGAGGTTTTGTGG - Intronic
1046628296 8:116598502-116598524 GGCTCTGGTGAGAAGCACTGAGG - Intergenic
1046731775 8:117733785-117733807 GGGGCGGGGGGTAGGCATTGAGG + Intergenic
1046948742 8:120000304-120000326 GGGGCTGGAGGGGGGCCTTGGGG - Intronic
1047546882 8:125826714-125826736 GGGTCTGGTGGGAGGTATTTGGG + Intergenic
1047956620 8:129981436-129981458 GGGGCTGGAGCCAGGCACAGTGG - Intronic
1048295859 8:133212858-133212880 GGGGCTGGAGAGAGGGCCTGCGG - Exonic
1048531900 8:135257286-135257308 GGCCCTGGTGGGATCCACTGGGG - Intergenic
1048976429 8:139675402-139675424 GGGGCTGGTAGGAGGCAATTAGG + Intronic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1049222236 8:141433414-141433436 GGGGGTGGAGGGAGACGCTGGGG + Intergenic
1049230068 8:141477353-141477375 GAGGCTGCTGCGTGGCACTGAGG + Intergenic
1049248168 8:141573925-141573947 GAGGCTGGCAGGAGTCACTGAGG - Intergenic
1049326892 8:142026251-142026273 GAGGCTGGTGGGAAGGACTGGGG - Intergenic
1049378566 8:142301081-142301103 AGGGAAGGTGGGGGGCACTGTGG - Intronic
1049378588 8:142301148-142301170 AGGGCAAGTGGGGGGCACTGTGG - Intronic
1049378612 8:142301215-142301237 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378680 8:142301406-142301428 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378727 8:142301535-142301557 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049379910 8:142306936-142306958 GGTGCTGGAGGGAGGCCCCGGGG - Intronic
1049441928 8:142613566-142613588 GCGGCAGGTGGGCGGCTCTGAGG - Exonic
1049579428 8:143404629-143404651 GGGGCAGGCGGGAGGCTCTGGGG + Intergenic
1049587440 8:143438589-143438611 GGGCCTGGAGGCAGGCAGTGTGG + Intronic
1049589594 8:143451052-143451074 GGGGCTGCTGTGGGGGACTGCGG + Intronic
1049849133 8:144821409-144821431 CTGGCAGGTGAGAGGCACTGGGG - Intergenic
1049883788 9:14898-14920 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1050094340 9:2047636-2047658 GGTGCTGAGGGGAGGCACCGGGG + Intronic
1050160035 9:2708835-2708857 GGGGCTGGTGGGAGGTGCTAAGG - Intergenic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051250903 9:15157793-15157815 GTGGCTGGCCTGAGGCACTGAGG - Intergenic
1051364173 9:16309378-16309400 GGGGATGGGGAGAGGCACTAGGG + Intergenic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1053575727 9:39356320-39356342 GGCCCTGGTGGGAGGCCCTCAGG - Intronic
1053648514 9:40140136-40140158 GGGTCTGGTGGGAGGTGATGGGG - Intergenic
1053757227 9:41323708-41323730 GGGTCTGGTGGGAGGTGATGCGG + Intergenic
1053840247 9:42184277-42184299 GGCCCTGGTGGGAGGCCCTCGGG - Intronic
1054097297 9:60915025-60915047 GGCCCTGGTGGGAGGCCCTCAGG - Intergenic
1054118703 9:61190654-61190676 GGCCCTGGTGGGAGGCCCTCAGG - Intronic
1054329494 9:63738079-63738101 GGGTCTGGTGGGAGGTGATGGGG - Intergenic
1054536069 9:66236034-66236056 GGGTCTGGTGGGAGGTGATGGGG + Intergenic
1054589054 9:66991910-66991932 GGCCCTGGTGGGAGGCCCTCAGG + Intergenic
1055102826 9:72482713-72482735 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1055531421 9:77187993-77188015 GGGACTGGTGGGAGGCAGTTGGG + Intronic
1055621511 9:78130228-78130250 GGGGTGGGTCAGAGGCACTGAGG + Intergenic
1055987065 9:82063022-82063044 GGGCCTGGTGGGAGGCCCTCGGG + Intergenic
1056215292 9:84400649-84400671 AGGGTTGGTAGGAGGCACTGTGG + Intergenic
1056487705 9:87075731-87075753 GGAGCTGGGGGGCAGCACTGAGG - Intergenic
1056827024 9:89883590-89883612 GGAGGTGGAGGGAGGCACTGTGG - Intergenic
1057067834 9:92072224-92072246 GGGGCTGGTCTGAGGTCCTGAGG - Intronic
1057313854 9:93956965-93956987 GGGGCAGGTGCCAGGGACTGAGG - Intergenic
1057444617 9:95104851-95104873 GGGGCTGGGGAGGGGCAGTGGGG - Intronic
1057619110 9:96619435-96619457 GGGGCTGGCGGGAGCCTCGGCGG - Exonic
1057798633 9:98175601-98175623 GAGGCTGTAGGGAGGCTCTGAGG + Intronic
1057836733 9:98451515-98451537 GGGGCAGTGGGGAGGCACTTGGG - Intronic
1057905023 9:98976607-98976629 GGCCCTGGTGAGAGTCACTGAGG - Intronic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1058686927 9:107488208-107488230 GGGGCGGCCGGGAAGCACTGGGG + Exonic
1058809457 9:108625578-108625600 GGGGCTGGGGCCAGGCACAGTGG + Intergenic
1059318315 9:113446005-113446027 GGGTTTGGTGGGAGGGAGTGAGG + Intronic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1059865589 9:118510516-118510538 GGGGCCTGTGGGGGGCAGTGGGG + Intergenic
1060228064 9:121808280-121808302 GGGCCAGGAGGGAGGCTCTGGGG - Intergenic
1060408193 9:123382981-123383003 GGGCCTGGTAGGAGGCACCTTGG + Intronic
1060920557 9:127417702-127417724 TAGGCGGGTGGGAGGCCCTGGGG + Intergenic
1060985793 9:127818293-127818315 GGGGCCTGAGGGAGGCACCGTGG - Exonic
1060992057 9:127854805-127854827 TGGGATGGGGGGAGGCAGTGGGG + Intergenic
1061020161 9:128009155-128009177 GGGGCATGCTGGAGGCACTGGGG + Intergenic
1061264576 9:129497571-129497593 GGAGAGGGTGGGAGGGACTGGGG + Intergenic
1061266046 9:129505622-129505644 GGAGCGGGTGGGAGGCACAAAGG + Intergenic
1061288056 9:129635468-129635490 GGGGCTGGCAGGAGAAACTGAGG + Exonic
1061291590 9:129653564-129653586 GGGACTGGGGAGGGGCACTGGGG - Intergenic
1061320119 9:129823478-129823500 GGGGCTGGGGGATGGCACTAGGG - Intronic
1061328282 9:129877175-129877197 GGGCCTGGTGAGAGACACTGAGG + Intronic
1061853463 9:133429174-133429196 GGGGCAGGTGGGTGGGACGGGGG - Intronic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1062060769 9:134494090-134494112 TGGGGTGGTGGATGGCACTGGGG + Intergenic
1062091097 9:134679287-134679309 CGGGCTGGTTGGGGGTACTGTGG + Intronic
1062091138 9:134679417-134679439 GGGGCTGGTTGGGGGCACTGTGG + Intronic
1062091146 9:134679438-134679460 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091160 9:134679481-134679503 GGGGCTGGTTAGGGGCACTGTGG + Intronic
1062091175 9:134679523-134679545 AGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091189 9:134679566-134679588 GGGGCTGGCTAGGGGCACTGTGG + Intronic
1062091203 9:134679606-134679628 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091218 9:134679649-134679671 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062091250 9:134679756-134679778 GGGGCTGGTTGGGGGCACTGCGG + Intronic
1062111280 9:134783333-134783355 GTGGGTGCTGGGAGGGACTGGGG + Intronic
1062154472 9:135038986-135039008 GGGCCTGGTGGGAGGTGCTTGGG + Intergenic
1062221433 9:135418165-135418187 GGGGCTGAGGGGAGGAGCTGAGG + Intergenic
1062326319 9:136014213-136014235 GGGGAGGGTGGGGGGCGCTGTGG - Intronic
1062437806 9:136554374-136554396 GGGGGTGGAGGGAAGCACAGAGG - Intergenic
1062520363 9:136955156-136955178 GGGGCTGTTGGGAGCCGCTGTGG + Intronic
1062526750 9:136981000-136981022 GGGCCGGGCGGGAGACACTGGGG + Intronic
1062526986 9:136981907-136981929 GGGGTGGGTGGGAGACAGTGAGG - Intronic
1202796277 9_KI270719v1_random:123433-123455 GGGTCTGGTGGGAGGTGATGGGG - Intergenic
1185462397 X:339410-339432 GGGGTGGGTGGGAGGAGCTGGGG + Intronic
1186195905 X:7110161-7110183 GGGGCTTATGGGAGGCATTAAGG + Intronic
1186251739 X:7675017-7675039 GGGGCTGGTGGGAGGGAAAATGG + Intergenic
1186426921 X:9469765-9469787 GGGGCTGGGGGGGGTGACTGTGG - Intronic
1186467842 X:9797788-9797810 GGGGCTGGCCGGAGGCACAGTGG + Intronic
1186803311 X:13115014-13115036 GGGTCTGGTGGGAGGTATTTGGG - Intergenic
1187174904 X:16887548-16887570 GGGTGTGGGGGTAGGCACTGTGG - Intergenic
1187425794 X:19176350-19176372 GATGGTGGTGGGAGGTACTGTGG - Intergenic
1187455747 X:19439956-19439978 GCAACCGGTGGGAGGCACTGGGG + Intronic
1187943974 X:24408644-24408666 GGTGCTGGTGGGGGCCACTAGGG + Intergenic
1188043792 X:25402295-25402317 GGTGTTAGTGGCAGGCACTGGGG + Intergenic
1188173701 X:26961470-26961492 GGGGCTGGGGTGAGGAAATGGGG + Intergenic
1189109048 X:38268098-38268120 GGGCCTGGTGGGAGGTATTTAGG + Intronic
1189756760 X:44279974-44279996 GGGGCTGGTGGTGGACAGTGTGG - Intronic
1190225156 X:48539643-48539665 GGGCCAGGTGGGAGGGACGGTGG + Exonic
1190277047 X:48905489-48905511 GTGGCACGTGGAAGGCACTGAGG + Intronic
1190326470 X:49209904-49209926 GGGGCTGGCGCGGGGAACTGGGG + Intronic
1190461091 X:50676211-50676233 GTGGCTGATGGGAGGCCCTAGGG + Intronic
1191955533 X:66639131-66639153 GGGGCTGATGGGCGGGTCTGAGG - Intronic
1192123706 X:68480991-68481013 AGGGCTGGTGGTGGGCAATGGGG + Intergenic
1192204677 X:69088165-69088187 GAGGCTAGGGGGAGGCAGTGAGG + Intergenic
1192260796 X:69504989-69505011 GGGGGCGGTGCGGGGCACTGGGG - Intergenic
1192266756 X:69543833-69543855 GGGGCTGGGGTGGGGCACAGAGG + Intergenic
1192267755 X:69551412-69551434 AGGGATGGTGGGAGGGAATGGGG + Intergenic
1192404789 X:70873951-70873973 GGGGCTGATGGGAGGTACTTGGG + Intronic
1193255377 X:79342527-79342549 AGGGCTAGTGGCAGCCACTGTGG - Intergenic
1193402443 X:81062074-81062096 AGGGCGGGTGGGAGGGGCTGAGG - Intergenic
1194214440 X:91110958-91110980 GGGGCTTGAGGCAGCCACTGTGG + Intergenic
1194231545 X:91331230-91331252 AGTGCTGTTGGGAGGCACAGTGG + Intergenic
1195171139 X:102269700-102269722 GGGCCTGGTCGGGGGCACCGGGG - Intergenic
1195187721 X:102417399-102417421 GGGCCTGGTCGGGGGCACCGGGG + Intronic
1195316842 X:103687480-103687502 GGGACTGGTGAGAGCCACGGCGG + Intronic
1195509053 X:105693300-105693322 GGGCCTGGTGGCAGGTACTTGGG + Intronic
1196278886 X:113799622-113799644 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1196468151 X:115993676-115993698 TGGGCTGGTGTGTGGCCCTGAGG - Intergenic
1196604703 X:117643687-117643709 GGAGCTGGTGGGAGGCCCTTAGG + Intergenic
1196662537 X:118282995-118283017 GGGCTTGGTGGGGGGCAATGGGG - Intergenic
1198130006 X:133684320-133684342 AAGGCTGGTGGGAGGGACAGAGG - Intronic
1198264931 X:135000137-135000159 GGGCCTGGTGGGAGGTATTTGGG + Intergenic
1198458160 X:136837827-136837849 GGGGCTGATGGGAGGGCTTGGGG + Intergenic
1199541043 X:148958409-148958431 GGGGCTGGTGAGATGCAAGGAGG - Exonic
1199649968 X:149940455-149940477 GGAGCTGGGGGGCGGAACTGTGG + Intergenic
1199760391 X:150899811-150899833 GGGGTTGGTGGGAGCCACTGAGG - Intergenic
1199845817 X:151692578-151692600 GGGGCTGGGGAGGGGCAATGTGG + Intergenic
1200071313 X:153530808-153530830 GGGGCCGGTGGGGGGCAGAGGGG + Intronic
1200109841 X:153734921-153734943 GGGGCTGGAGAGAGGGAATGAGG - Intronic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1200402023 X:156025261-156025283 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic
1200924758 Y:8644508-8644530 AGTGCTGCTGAGAGGCACTGTGG - Intergenic
1201038264 Y:9804478-9804500 AGTGCTGTTGAGAGGCACTGTGG - Intergenic
1201176013 Y:11308526-11308548 GGGGCTGGTGGGTGGGGGTGGGG - Intergenic
1201567876 Y:15385411-15385433 GGGGTTCATGGGAGGCATTGTGG + Intergenic