ID: 1157134545

View in Genome Browser
Species Human (GRCh38)
Location 18:45040922-45040944
Sequence CAGCACCTGGGGTAGATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157134545 Original CRISPR CAGCACCTGGGGTAGATATC TGG (reversed) Intronic
900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG + Intergenic
902831584 1:19017004-19017026 CTGCACCTGGGCTGGAAATCAGG + Intergenic
903804455 1:25994758-25994780 CAGCACTTGGGATAGGAATCAGG + Intronic
907283704 1:53367272-53367294 CAACACCTGGGGAAGAGATAGGG + Intergenic
917412214 1:174770865-174770887 CAGTCCCTGGGTTAGATGTCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919792898 1:201303811-201303833 CAGCACTTGGGGGAGATTCCGGG + Intronic
920670700 1:208001957-208001979 CATCACCTGGGCTCGAAATCTGG + Intergenic
1066412603 10:35188225-35188247 CAGATCCTGGGTTAGAAATCTGG - Exonic
1066434984 10:35389330-35389352 CAGCCCCTGGTGTACATATATGG + Intronic
1067063438 10:43089900-43089922 CAGGACTTGGGGCAGAGATCGGG + Intronic
1067392107 10:45873394-45873416 CAGCATTTGAGGTAGGTATCTGG + Intergenic
1067402826 10:45993006-45993028 CAGCATTTGAGGTAGGTATCTGG - Intronic
1070986319 10:80693037-80693059 CAGCAGCTGGGGGAGAAAGCTGG + Intergenic
1072332976 10:94371661-94371683 CAGATGCTGGAGTAGATATCTGG - Intergenic
1072540192 10:96392611-96392633 CAGAACCTGGGGTGGAAGTCAGG + Intronic
1078111135 11:8393572-8393594 CAGCCACTGGGGTAGAGATAGGG + Intronic
1083777968 11:64903420-64903442 CAGCACCTGGGGGAAGGATCCGG + Intronic
1085582554 11:77667560-77667582 CAGGACGTGGGGTGAATATCGGG - Intronic
1088675088 11:112184789-112184811 CTGCACTTGGGGTAGAAATAAGG - Intronic
1099068985 12:78021841-78021863 CAGTGCCTGGAGGAGATATCTGG + Exonic
1104886837 12:132115236-132115258 CAGCACCTGGAGGTGACATCAGG + Intronic
1109854124 13:68106855-68106877 CAGCAGCTGGGGTGGATTTAGGG - Intergenic
1110480620 13:75970945-75970967 CAGCCACTGTGGTAGACATCAGG + Intergenic
1111133367 13:84005644-84005666 CAGCACCACAAGTAGATATCCGG + Intergenic
1113568790 13:111338946-111338968 CAGCACCGAGGGCTGATATCTGG - Intronic
1117387524 14:55230959-55230981 AAGAACCTGGGGTAGGTATCTGG + Intergenic
1123885897 15:24728162-24728184 CGGCAGCTGGGGTATATATTAGG - Intergenic
1127152303 15:56089030-56089052 CATCACCTAGGGAAGATATTAGG - Exonic
1137668189 16:50263798-50263820 GAGCCGCTGGGGGAGATATCGGG - Intronic
1138182763 16:54953580-54953602 CTGCGCCTGGGGTGGATATTTGG + Intergenic
1138505410 16:57475941-57475963 CAGCACCTCCGGTAGATCTGTGG + Exonic
1141346040 16:83246980-83247002 CAGCATCCGGGGTAGATGCCTGG + Intronic
1145863368 17:28225663-28225685 CAGCACCTGGAGTAGCCATGTGG - Intergenic
1146806142 17:35866609-35866631 CAGCCCCAGGGGTAAATGTCAGG + Intronic
1147817457 17:43220581-43220603 GAGCAGCTGGGGAAGATAACGGG - Intergenic
1147927584 17:43955055-43955077 CAGCACCTGGAGTAGCCATTGGG + Intronic
1149525046 17:57348929-57348951 CAGCACCTGGGAGAGTTAACAGG - Intronic
1153988610 18:10375381-10375403 CAACCCCTGAGGTAGACATCAGG - Intergenic
1156154823 18:34288944-34288966 CAGCTCCTGGTGAAGATCTCAGG + Intergenic
1157134545 18:45040922-45040944 CAGCACCTGGGGTAGATATCTGG - Intronic
1157566618 18:48682923-48682945 CAACACCTGGGGTGGAGATGTGG + Intronic
1159651453 18:70983672-70983694 CAGCATCTGGGGGAGATCTGAGG + Intergenic
1161268054 19:3374258-3374280 CAGCAGCTGGGAGAGACATCTGG - Intronic
1166985919 19:46660115-46660137 CAGCGCCTGGGGGAGACTTCTGG - Intronic
1167076651 19:47254236-47254258 CAGCACCTGTGGGAGATGCCTGG - Intergenic
1167135078 19:47610777-47610799 CAGCACCTGGGGTGGGTGTGGGG + Intronic
1168713151 19:58513034-58513056 CAGCACCAAGGGCAGATATATGG + Intergenic
926297144 2:11577251-11577273 CAGCATCTGGGGTAGGGACCAGG + Intronic
926561171 2:14419094-14419116 CAGCAACTGGTAAAGATATCAGG + Intergenic
929195524 2:39180604-39180626 CAGCAGCTGGAGTTGATATATGG - Intronic
931393267 2:61863274-61863296 CAGCACCTGGGGGACAAAGCAGG + Intergenic
933190141 2:79325112-79325134 CTGCACCTGGGGGAGATTTTAGG - Intronic
935859377 2:107311556-107311578 TATCACCTCTGGTAGATATCTGG + Intergenic
939341814 2:140905640-140905662 CGCCACCTGGGTTAGATAACTGG - Intronic
939998568 2:148943667-148943689 CAGCACTTGGGGCAGCTATAAGG - Intronic
940133383 2:150409315-150409337 CAGCTTCTGGGGCAGATAGCAGG - Intergenic
944441627 2:199749164-199749186 CATCACCTGGGGCACATACCTGG + Intergenic
947666713 2:231910597-231910619 CAGGAACTGGGCTAGATGTCGGG + Intergenic
1169939508 20:10921483-10921505 CAGCACCTGGTGTAGCACTCAGG + Intergenic
1174439160 20:50535235-50535257 CAGCACCTGTGTTAGGAATCTGG - Intronic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
1184885342 22:47341707-47341729 CATCACCTGGGATAGATCCCGGG - Intergenic
960509761 3:118535100-118535122 CAGGACCTGGGTTTGATATCTGG - Intergenic
960955357 3:123027380-123027402 CAGCAACTCGGGTGGGTATCGGG - Intronic
967708751 3:192681772-192681794 CAGCTTCTGGAGTAAATATCTGG - Intronic
967915255 3:194573680-194573702 CAGACCCTGGGGTGGATCTCTGG + Intergenic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
969284699 4:6195822-6195844 GAGCAGCTGGGGGAGACATCTGG - Intronic
986115388 5:4768771-4768793 CACCACATGGGGTTGATCTCAGG - Intergenic
986371879 5:7088143-7088165 CAGCACCTGGAGCAGATGGCTGG + Intergenic
988530330 5:32021887-32021909 TAGCTCCTGGGGCAGACATCTGG + Intronic
988864545 5:35320864-35320886 CAGAAACTGCGCTAGATATCAGG + Intergenic
989070413 5:37504867-37504889 CTGCTCTTGGGGTAGATATAAGG + Intronic
993595950 5:89855871-89855893 CAGCACATGGCGTTTATATCAGG - Intergenic
997509961 5:134447255-134447277 AACCACCTGGGGTAGAAATAAGG + Intergenic
997718317 5:136058435-136058457 CAGCAACTGGGGCAGGCATCTGG - Intronic
1000165940 5:158648752-158648774 CAGCAACTGGGGGAGAGGTCTGG + Intergenic
1006805943 6:36789214-36789236 CAGCACCAGGGGTCTATGTCGGG - Intronic
1007162125 6:39800314-39800336 CTGGGCCTGGGGTAGCTATCAGG + Intronic
1007988771 6:46233537-46233559 CAGAACCTGGGGTTGAGATGAGG + Intronic
1008208640 6:48694067-48694089 CAGCTCCTGGGGAAGAGATTGGG + Intergenic
1008767397 6:54935479-54935501 AAGATCCTGGGGCAGATATCTGG + Intronic
1023584815 7:41718194-41718216 AAAAACCTGGGGTAGATGTCTGG + Intergenic
1036142553 8:6221834-6221856 AAGCAGCTGGAGTAGGTATCAGG + Intergenic
1036173878 8:6517656-6517678 CAGCCCCTGGGGTAGAACTTGGG - Intronic
1036503455 8:9334491-9334513 CTGCAACTGGGGATGATATCTGG + Intergenic
1037107766 8:15130346-15130368 CAGCACACTGGGTAGATATGTGG - Intronic
1038526268 8:28276303-28276325 TAGCACCTGGGTCAGATATTGGG - Intergenic
1040490113 8:47912274-47912296 GAGCACCTGGGGTAGCAGTCAGG + Intronic
1040953410 8:52957428-52957450 CAGCCCCAGGTGCAGATATCAGG + Intergenic
1043366654 8:79541161-79541183 CAGCACCTGTGAAAAATATCTGG - Intergenic
1044095391 8:88057509-88057531 CACCTCCTGGGGTTAATATCTGG + Intronic
1056576670 9:87859937-87859959 CAGCACCTGGGCCAGATGCCAGG - Intergenic
1056696269 9:88856658-88856680 CAGCACCTGGTGGAGGTAGCTGG - Intergenic
1059839078 9:118191911-118191933 CAGCAGCTGTGGTAGACATGGGG + Intergenic
1062478227 9:136740115-136740137 CAGCTCCTGGGGTAGGGATGGGG - Intronic
1189398834 X:40646939-40646961 CAGCACTCGGGGTGGCTATCTGG - Intronic
1192078435 X:68023802-68023824 CAGTTCCTCGGGTAGAAATCTGG + Intergenic
1196586263 X:117432456-117432478 CAGTAACTGGGGAAGACATCAGG - Intergenic