ID: 1157135658

View in Genome Browser
Species Human (GRCh38)
Location 18:45052092-45052114
Sequence GTACAGTGCCTGGCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 1, 2: 21, 3: 205, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157135658 Original CRISPR GTACAGTGCCTGGCACAAAC TGG Intronic
900757802 1:4449328-4449350 GCACAGTGCCTCGCACAAGGTGG - Intergenic
901036020 1:6336728-6336750 GAACAGTGCCTGGCACACTGTGG - Intronic
901096900 1:6688901-6688923 GCACAGTGCCAGGCACATAATGG - Intronic
901350124 1:8588039-8588061 TTACAGTGCATGGCACATAGTGG - Intronic
901367974 1:8770274-8770296 GTACAGTACCTGACACAGAATGG + Intronic
901634586 1:10664687-10664709 GCACAGTACCTGGCACAAGAGGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901789853 1:11648417-11648439 GCACAGTGCTTGCCACAAAGTGG - Exonic
902072692 1:13754237-13754259 GTGCAGCGCCTGGCAGAAAAAGG - Intronic
902210932 1:14903986-14904008 TTCCAGTGCCTGGCACCAGCAGG + Intronic
902275335 1:15335624-15335646 GCACAGTGGCTGGCACACAGGGG - Intronic
902280668 1:15371906-15371928 ATACAGAGCCTGTCAGAAACAGG - Intronic
902490918 1:16779818-16779840 GCACAGTGGCTGGCACAGAGTGG + Intronic
902531201 1:17091858-17091880 GAACAGGGCCTGGCACCAAAGGG + Intronic
902551225 1:17220787-17220809 GTGCAGTGCCTGGCACAGAGAGG + Intronic
902603176 1:17553848-17553870 GCACAGTGCCTGGCACCCAGTGG - Intronic
902661716 1:17908935-17908957 GTACAATACCTGGCATAAAGTGG + Intergenic
902796570 1:18804329-18804351 GCACAGGGCCTGGCACACATAGG - Intergenic
902916219 1:19641257-19641279 GCATAATGCCTGGCACAAAATGG + Intronic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903175320 1:21576944-21576966 GCATAGTGCCTGGCACAAGTAGG + Intronic
903781267 1:25821336-25821358 GCACAGAGCCTGGCACACAGAGG + Intronic
903834409 1:26193607-26193629 GCACAGTGCCTGGCACGCACAGG + Intronic
904238196 1:29127462-29127484 GTTGAGTGCCTGGCACAAAGTGG + Intergenic
904272369 1:29358569-29358591 GCACAGAGCCTGGCACAGAGTGG - Intergenic
904330468 1:29755082-29755104 GCACAGTGCCTGGTACACAGTGG + Intergenic
904339879 1:29827879-29827901 GCACAGTGCCTGGTACACAGTGG + Intergenic
904386677 1:30147145-30147167 GTCCAGTGCCTGCCACAAAGTGG - Intergenic
904441242 1:30533360-30533382 GCACAGTGCCTGGTGCATACAGG + Intergenic
904447580 1:30587437-30587459 GCACAGTGGCTGGCACACAGTGG - Intergenic
904809001 1:33151263-33151285 GTACAGGGCCTGCCACTCACTGG + Intronic
904812229 1:33170907-33170929 GCACAGAGCCTGGCACACCCTGG + Intronic
904894075 1:33800918-33800940 GCACAGGGCCTGGCACAGAGAGG + Intronic
904966785 1:34380328-34380350 GTTCAGTGTCTGGCACAAAGCGG + Intergenic
905092315 1:35439443-35439465 GCACAGGGCCTGGCACATAGTGG + Intronic
905227085 1:36486084-36486106 GTACAGTGCCGGACACACAGAGG + Intergenic
905788269 1:40775221-40775243 GCACAGAGCCTGGCACCAAGGGG + Intergenic
905860703 1:41349274-41349296 GTACAGTGCCTGACACTATTAGG - Intergenic
905888555 1:41505126-41505148 GTACAGTTCCTGGCGCACAGTGG - Intergenic
905996708 1:42387595-42387617 GTACAATGCCTGGCACAGAGTGG - Intronic
906484705 1:46225176-46225198 GTATGGTGCCAGGCACACACTGG + Intergenic
906554099 1:46693782-46693804 GCAAAGTGCCTGGTACATACTGG + Intronic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906811594 1:48832536-48832558 GCTCAGAGCCTGGCACAAAGAGG + Intronic
907072652 1:51550960-51550982 GTAAAGTGCCTGATACAAATAGG - Intergenic
907121236 1:52009890-52009912 GTACTGTGGCTGGCAGAAAAGGG + Intergenic
907238492 1:53067451-53067473 GTACAGGCCCAGGCACAAATAGG + Intronic
907263274 1:53238143-53238165 GAACAGAGCCTGGCACACAGTGG + Intronic
907294427 1:53440377-53440399 GCACAGGGCCTAGCACAAAGTGG - Intergenic
907376638 1:54049407-54049429 ATACAGTGCCTGGCACATTGTGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907491061 1:54809058-54809080 TTGCAGTGCCTGGCACACATAGG + Intronic
907775646 1:57511692-57511714 GTACAATGCCTAGCACATAGTGG + Intronic
907882973 1:58568583-58568605 GCACAGTGCCTGGAGCATACTGG - Intergenic
907898211 1:58713173-58713195 GAACAGTGTCTGGCACATAGTGG - Intergenic
907925950 1:58955347-58955369 GAACAGTGCCTGCCACATAGTGG + Intergenic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
908663515 1:66463730-66463752 GAACAGTGCCTGACACATAATGG + Intergenic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
908848161 1:68346092-68346114 TTACAGTGCCTTTCACCAACAGG - Intergenic
909061746 1:70886762-70886784 GCACAGATCCTGGCACACACTGG + Intronic
909116283 1:71541250-71541272 GCACAGTGACTGGCATATACAGG + Intronic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909768492 1:79388791-79388813 GCACAGTGCCTAGAACAAATAGG - Intergenic
910259029 1:85278114-85278136 GAACAGTGTCTGGCACATAGTGG - Intergenic
910400714 1:86835346-86835368 GTAAAGTTCCTGGCACACAATGG - Intergenic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910551437 1:88480074-88480096 GCACTGTTCCTGGCACAAGCGGG + Intergenic
910789610 1:91037560-91037582 GTACAGTGCCAGGCACACAGGGG - Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911645491 1:100333413-100333435 GAACAGTACCTGGCACATAATGG - Intergenic
912200139 1:107447971-107447993 GCACAATGTCTGGCACATACTGG - Intronic
912369496 1:109163009-109163031 GCTCAGTGACTGGCACAGACTGG - Intronic
912558365 1:110532344-110532366 GCACAGTGCCAGGCACACAGGGG - Intergenic
912713471 1:111965896-111965918 GCAGAGTGCCTGGCACACAGAGG - Intronic
913119918 1:115730456-115730478 GAAGAGTGCCTGGCACATAAAGG + Intronic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914898810 1:151700381-151700403 CTACAGTGTCTGGCACATAACGG - Intergenic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG + Intergenic
916561191 1:165935184-165935206 GCGCAGTCCCTGGCACAAATGGG + Intergenic
916628227 1:166582884-166582906 GAACAGTTCCTGCCACAAACTGG + Intergenic
916730832 1:167565261-167565283 GAACAGTGCCTGGGCCACACAGG + Intergenic
916894195 1:169144668-169144690 GAACAGTGAATGGCACAAACAGG + Intronic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917795650 1:178531017-178531039 GAACAGTGCCAGGCACTAGCAGG + Intronic
917977084 1:180246885-180246907 GCACGGTGCCTGGCACACAAGGG - Intronic
918122806 1:181554617-181554639 GCTCAGTGCCTGGCACAGGCTGG - Intronic
918396102 1:184114641-184114663 ATACAGTGCCTGCCCCAGACTGG - Intergenic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919503050 1:198362246-198362268 GCACAGTGTCTGGCACTAATAGG - Intergenic
919771178 1:201159866-201159888 GTAGAATGCCTGACATAAACTGG - Intronic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919905649 1:202076626-202076648 GAATGGTGCCTGGCACAAAGTGG - Intergenic
920059926 1:203220117-203220139 GGACAGCGCCTGGCACACAGTGG - Intronic
921034927 1:211367843-211367865 GGACAGTGCCTGGCACAGAGAGG - Intronic
921075874 1:211699612-211699634 GCACAGTGCCTGGCACATCAAGG - Intergenic
921183643 1:212651912-212651934 CAACAGTGCCTGCCACAATCAGG - Intergenic
921207394 1:212859947-212859969 GCACAGTTCCTGGCACATAAGGG + Intronic
921294688 1:213690816-213690838 GCACAGTGGCTTGCACAAAGTGG + Intergenic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921516163 1:216095034-216095056 GAATAATGCCTGGCACAAAGAGG + Intronic
921667223 1:217887533-217887555 GAACAGTGCCTGGCATAGAAGGG - Intergenic
921848543 1:219909257-219909279 GAACAGTACCTGGCACATAGTGG - Intronic
922606056 1:226890642-226890664 GCACAGTGCCTGTCACAAAATGG - Intronic
922619270 1:226980338-226980360 GAACGGTGCCTGGCCCAATCCGG - Intronic
923529527 1:234802718-234802740 GCACAGTGGCTGGCACAGACTGG - Intergenic
924186838 1:241501577-241501599 GTACAGTGCCTGATAGAAAATGG + Intronic
924655661 1:245972967-245972989 TTATAATGCCTGGCACAAATTGG + Intronic
924668729 1:246101398-246101420 GCAGAGTGTCTGGCACAAAATGG + Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064597470 10:16960570-16960592 GTACAGAACCTGGCACATACAGG + Intronic
1065537912 10:26732668-26732690 GAACAGTGCCTAGCACATAGTGG + Intronic
1065660886 10:28003268-28003290 ATGGAGTGCCTGGCACAAAATGG - Intergenic
1065765725 10:29027794-29027816 GACCAGTGCCTGGAACAAAATGG - Intergenic
1066379840 10:34891913-34891935 CTACAGTGCCTGGCACATTGTGG - Intergenic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067721839 10:48733345-48733367 GCAAAGTGCCTGACACAAATTGG - Intronic
1067775950 10:49164995-49165017 GCACAGTGCCAGGGACAAAGTGG - Intronic
1067781208 10:49208840-49208862 GTACAGTGTTTGGCACACACAGG + Intergenic
1068941269 10:62683541-62683563 GCACAGTGTCTGGCATAAAGTGG + Intergenic
1069672659 10:70222450-70222472 GAAAAGTGCCTGGCACATCCTGG - Intronic
1069864405 10:71492672-71492694 GAGGAGTGCCTGGCACAGACAGG - Intronic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070275672 10:75004272-75004294 GCACAGTGCCTAGCACATAGAGG + Intronic
1070338053 10:75472327-75472349 GGACAGTGCCTGGTACATAATGG - Intronic
1070344063 10:75524508-75524530 ATACAGTGCCTGGCATACATAGG + Intronic
1070740988 10:78903149-78903171 GTACAGAGCCTGGCACTTAGTGG - Intergenic
1070744801 10:78927317-78927339 GTGCAGTGCATGGCACACAGAGG + Intergenic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1071821186 10:89282690-89282712 GAATAGTGCCTGGCACATAATGG - Intronic
1072316219 10:94205921-94205943 GAACAGTGCATGGCACACAGTGG - Intronic
1072449063 10:95524814-95524836 GCATAGTGCCTGGCACATAATGG + Intronic
1072618706 10:97066222-97066244 GGACAGTGCCTGGCCCACAGTGG + Intronic
1072739744 10:97902250-97902272 GTAAAATGCCTGGCACAGAGTGG + Intronic
1072820552 10:98552381-98552403 GAACTGTGCCTGGCACATATAGG + Intronic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073489702 10:103844822-103844844 ATGCAATGCCTGGCACAAAATGG + Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073820127 10:107252570-107252592 GTCCAATGCTTGGCACAGACTGG + Intergenic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1074258780 10:111830998-111831020 ATAGAGTGCCTGACACACACTGG - Intergenic
1074338993 10:112607506-112607528 GCACAGTGCCTGGCCTAAAATGG + Intronic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1074947667 10:118296924-118296946 GTACAGTGCCTGGCATGTACTGG + Intergenic
1075306714 10:121374498-121374520 GTACAGAGCCTGGGACATAAGGG - Intergenic
1075531531 10:123234305-123234327 GTACAGTGCCTGGCAGTAGTAGG - Intergenic
1075933125 10:126316258-126316280 GCACAGGGCCTGGCACATAAAGG + Intronic
1075933927 10:126323591-126323613 GTGCAGTGCTTGGCACAGAGTGG - Intronic
1075960762 10:126566316-126566338 GCACAGTGCCTGACACATAGGGG - Intronic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078058091 11:8023782-8023804 GTAAAATGACTGGCACAAAGTGG + Intronic
1078539631 11:12202743-12202765 GTACAGAGCTTGGCACCTACTGG - Intronic
1078724184 11:13913971-13913993 GTACAGTTCCTGACACACACGGG - Intergenic
1078773650 11:14374369-14374391 GCTCAGTGCCTGGCACATAGAGG + Intergenic
1078851539 11:15168579-15168601 GCACACTGCATGGCACAAAAGGG - Intronic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079005019 11:16785448-16785470 GCACAGGGCCTGGCACACAGTGG - Intronic
1079096955 11:17517239-17517261 GTACAGTGCTTGGGCCAAGCTGG + Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1079417435 11:20252685-20252707 GTTCAGTGCCTGGCAAAACTCGG - Intergenic
1079818583 11:25094689-25094711 GTGCACAGCCTGGCACAGACTGG + Intergenic
1080036278 11:27715077-27715099 ATACAGTTCCTGGCACATAATGG + Intronic
1080127606 11:28755480-28755502 GCACAGTGCCTGGTACACAGAGG + Intergenic
1080329075 11:31114644-31114666 TTACAGTTCCTGGAACATACTGG - Intronic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1080565032 11:33500352-33500374 AAAAAGTGCCTGGCACATACGGG + Intergenic
1080677317 11:34439711-34439733 GAACAGTGCCTAGCACCTACAGG - Intronic
1081618438 11:44604235-44604257 GCACAGTGCCTGGCATGAAGTGG + Intronic
1081659887 11:44881640-44881662 GAACAGTGCCTGGCATACAGCGG - Intronic
1081662753 11:44898070-44898092 GAGCAGTGCCTGGCACATAGTGG - Intronic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081799229 11:45846536-45846558 GTACAGTGCTTTGCACACACTGG + Intergenic
1081866727 11:46364346-46364368 GCACAGTGCCTGACACATAGGGG + Intronic
1082186069 11:49182771-49182793 GTCCAGTGCCTTCCAGAAACAGG + Intronic
1083069677 11:59964408-59964430 TTACAGTGACTGGCAAAATCAGG + Intergenic
1083129837 11:60614996-60615018 GAACAATGCCTAGCACATACTGG + Intergenic
1083167978 11:60903207-60903229 GCACAGTGCCTGACACAACGAGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083965155 11:66039298-66039320 GTACAGGGCCTGGCACACAGAGG - Intergenic
1084934826 11:72581268-72581290 GTAAAGTGCCTGACACACAGGGG + Intronic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085300037 11:75452583-75452605 ACGCAGTGCCTGGCACACACAGG + Intronic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085914556 11:80869805-80869827 ATACAGTGTCTAGCACAAGCTGG - Intergenic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1086086155 11:82956964-82956986 GTACAGTGCCAGGTACAATCTGG - Intronic
1086239175 11:84668905-84668927 GAACAGTGCCTGGCACATTGTGG - Intronic
1086429913 11:86726654-86726676 GTACAGTGCCTGATACAGAGTGG + Intergenic
1086555414 11:88104627-88104649 GTACAGTAGTTGGCACAAAGTGG + Intergenic
1086680260 11:89662600-89662622 GTCCAGTGCCTTCCAGAAACAGG - Intergenic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087084407 11:94202035-94202057 GCACAGTCCCTGGCACACAGTGG - Intergenic
1087560909 11:99789222-99789244 GTACATTGTCTGGTACAAAATGG - Intronic
1087923861 11:103897155-103897177 GTACAGTGCCTGAAACATAATGG + Intergenic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1088219734 11:107556598-107556620 GTCCCATGCCTGGCACAAATAGG + Intronic
1088468014 11:110162811-110162833 GTAAAGTGCCTAGCACTAACCGG + Intronic
1088646976 11:111925375-111925397 GCACAGAGCCTGGCACACAATGG + Intronic
1088851182 11:113704814-113704836 GCACAGAGCCTGGCACAAAGTGG + Intronic
1089316211 11:117593051-117593073 GCACAGTTCCTGGCACTTACGGG + Intronic
1089469059 11:118706408-118706430 GAACAGTCCCTGGCACCCACAGG + Intergenic
1089481044 11:118805323-118805345 GTACAGTGCCTGGAACACAGTGG - Intergenic
1089604136 11:119631889-119631911 GGAGAGTTCCTGGCACAAAGTGG + Intronic
1089812523 11:121143625-121143647 GCACAGTGCCTGGCACTCAGTGG + Intronic
1089820556 11:121222101-121222123 GTTCAGTGTCTGGCACATAGTGG + Intergenic
1090210659 11:124919273-124919295 GCAGAGTGCCTAGCACATACTGG - Exonic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1090733610 11:129592359-129592381 GTATGGTGCCTTGCACACACTGG - Intergenic
1091181014 11:133604713-133604735 GGACAGTGCATGGTACACACAGG - Intergenic
1091386539 12:99542-99564 GTAGGGTGCCTGGCACACAGTGG + Intronic
1091655410 12:2342522-2342544 GCACAGTGCCTGGCACACTGAGG + Intronic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1091743628 12:2977064-2977086 GCACAGAGCCTGGCCCAAAAAGG - Intronic
1092844032 12:12567570-12567592 GTGCAGTGCCTGGCACATAAGGG - Intergenic
1092915783 12:13187893-13187915 GAACAGTGCCTGGCACATGATGG - Intergenic
1093394745 12:18667648-18667670 GCACAATGCCTTGTACAAACTGG - Intergenic
1093895470 12:24570184-24570206 GCACAGTCCCTGGCACAACTAGG - Intergenic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1094711921 12:32973064-32973086 GCACAGTGTCTAGCACAAAGTGG - Intergenic
1094749508 12:33389423-33389445 GTAAAGTGCCTGGTGTAAACAGG + Intronic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1095926310 12:47583127-47583149 GAACAGTGCCTGACACACAGTGG - Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096447117 12:51703465-51703487 ATATAGTGCCTTGCACAAAGAGG - Intronic
1097400479 12:59122479-59122501 GCACAGTGCCTTGCACATAATGG + Intergenic
1097659303 12:62411393-62411415 GAATAGTGCCTGGCACATAGTGG - Intronic
1097709941 12:62907250-62907272 CTGCAGTGCCTGGCACATGCTGG - Intronic
1098100051 12:67005661-67005683 GTGCAGTGCCTGGCACTCAGTGG - Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098646276 12:72905375-72905397 GAAGAGTGCCTGGCACATAGGGG + Intergenic
1099296867 12:80838908-80838930 GCAAAGTGCCTGGTGCAAACTGG + Intronic
1099362151 12:81717657-81717679 GGACAGTGCCTGGCATATATTGG - Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1100289195 12:93197997-93198019 GCAAGGTGCCTGGCACAAACTGG - Intergenic
1100511663 12:95280750-95280772 GAACAGTGCCTGGCACATCATGG + Intronic
1100658736 12:96674795-96674817 GCACTGTGCCTGGCACCAAAGGG - Intronic
1100760837 12:97805021-97805043 GTATAATGCCTGGCACATAGTGG + Intergenic
1101001205 12:100359784-100359806 GCCCAGAGCCTGGCACATACTGG + Intronic
1101440955 12:104704044-104704066 GTCCAATGCCTGGCACCAAGTGG + Intronic
1101598611 12:106189199-106189221 AGACAGTGCCTGGCACAGCCCGG - Intergenic
1101739841 12:107492355-107492377 GAACAGTGCCTAGCACAGAGGGG - Intronic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1101877213 12:108603717-108603739 GCACAGTTCCTGGCACACACAGG - Intergenic
1101981092 12:109407372-109407394 GCACAGTGCCTGGCACACATGGG + Intronic
1101993636 12:109508411-109508433 GTGCAGTGCCTGGCACAGAGTGG + Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102394054 12:112573448-112573470 GGACAGTGTCTGGCACACAGTGG - Intronic
1103139888 12:118539404-118539426 GCACAGTGCCTGGCACGTGCTGG + Intergenic
1103144142 12:118579637-118579659 TTCCAGTGCCTAGCACAAATTGG - Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1104071636 12:125350869-125350891 GTGCATTGGCTGGAACAAACAGG + Intronic
1104444968 12:128825163-128825185 GGACAGCGCCTGGCACATAGTGG + Intergenic
1105283409 13:18983521-18983543 GCACAGTGCCTGACACAGAGTGG - Intergenic
1105835164 13:24203878-24203900 GTACAGTGTCTGGCACCTAATGG - Intronic
1105913478 13:24892144-24892166 ATGCAGTGCCTGGCACACCCTGG + Intronic
1105955903 13:25282444-25282466 GAACAGTGCCTGGCCCAAGGAGG + Intronic
1106302476 13:28481599-28481621 GTACAGTGCCTGGCACATAATGG - Intronic
1106464916 13:30004928-30004950 GTATAGTTCCTGGCACACACGGG - Intergenic
1106548916 13:30754744-30754766 GCATAGTGCCTGGCACATAGGGG - Intronic
1107068376 13:36242662-36242684 ATAGAGTGCCTGGCATAAATTGG - Intronic
1107126155 13:36849160-36849182 GGACAGTGTCTTGCACAAAATGG + Intronic
1107445743 13:40469148-40469170 GCACAGTGCCTGCCACATATAGG - Intergenic
1107809827 13:44189562-44189584 GGATAGTGCCTGGCACAGAGGGG + Intergenic
1107831989 13:44382778-44382800 GCACAGTGCCAGGCACAGAGGGG - Intronic
1107840768 13:44454965-44454987 GAACAGTTCCTGACACAAAATGG - Intronic
1108014725 13:46062694-46062716 GTGCAGTGCCTGGCACAAGGAGG - Intronic
1108681866 13:52787471-52787493 GCACAGAGCCTGGCACACAGTGG + Intergenic
1109438359 13:62336061-62336083 GTACATTGCCTGACACATAGTGG - Intergenic
1110647880 13:77909670-77909692 GTACAGTGATTGGCACACAGTGG + Intronic
1111209205 13:85054009-85054031 ATACAGTGACTGCCTCAAACAGG + Intergenic
1111836745 13:93397632-93397654 GCACAGTACCTGGCACATAAAGG - Intronic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1113429335 13:110235974-110235996 GTACAGTCCCTGTCTCAAAAAGG + Intronic
1113436374 13:110294856-110294878 GAATAGTGCCTGGCACATAGTGG + Intronic
1113734584 13:112669163-112669185 GGGCTGTGCCTGGCACACACAGG + Intronic
1113802925 13:113095845-113095867 GAACTGTGCCTGGCACACAGCGG - Intronic
1114208042 14:20591543-20591565 GTACTGTGGCTGGCACACATTGG - Intronic
1114666952 14:24383501-24383523 GAACAGTGCCTGGCACTATTAGG - Intergenic
1114834738 14:26190655-26190677 GTACAGTGTCTGGGACACAGTGG - Intergenic
1115607652 14:35020743-35020765 GGACAGTGCCTGGCACAGAATGG - Intronic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1117885402 14:60356020-60356042 GAACAGTGTCTGGCACATATGGG + Intergenic
1118488522 14:66236340-66236362 GAATACTGCCTGGTACAAACAGG + Intergenic
1118497778 14:66325780-66325802 GAACAGTGCCTGGCACGTAAAGG + Intergenic
1118781879 14:69014038-69014060 GTATTGTGCCTGGCACTAAGGGG + Intergenic
1118820607 14:69343051-69343073 GAACAGTGCCTGTCATAAAATGG + Intronic
1118988086 14:70774166-70774188 GCACAGTGCCTGATACATACAGG - Intronic
1119112609 14:71989111-71989133 GCCCAATGCCTGGCACAAAGTGG - Intronic
1119369646 14:74128445-74128467 GAACAGTGCCTGGCACCACTGGG + Intronic
1119491453 14:75037445-75037467 GTACAGTCCCTGGCATACAATGG + Intronic
1119876360 14:78062992-78063014 GTACAATGCCCGGCACATGCAGG - Intergenic
1119892756 14:78195206-78195228 GCACAGTGCCTGGTTCATACTGG - Intergenic
1120179676 14:81330338-81330360 GCTCAGTGCCTGGCACACAAAGG - Intronic
1120927264 14:89810168-89810190 GCACAGTGTCTGGCACACAGTGG + Intronic
1120968963 14:90191707-90191729 TTCCAGTGCCTGGCACAGAGAGG - Intergenic
1121173673 14:91874671-91874693 GAATAGTGTCTGGCACATACAGG + Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121232038 14:92365205-92365227 TTATATTGCCTGGCACACACTGG + Intronic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121522553 14:94596270-94596292 GAACAGTGCCAGGCACACAGTGG - Intronic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122069643 14:99197295-99197317 GAGCAGTGTCTGGCACACACTGG - Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125063410 15:35452284-35452306 GTACAATGCCTGGATAAAACAGG + Intronic
1125106699 15:35979946-35979968 GTACTGTGCTTGCCACAAACTGG + Intergenic
1125350454 15:38761717-38761739 GCACAGTGCCTGACACATAGTGG - Intergenic
1125596778 15:40892691-40892713 GTACTGAGTCTGCCACAAACAGG + Intergenic
1125596982 15:40893672-40893694 GAACAGTGCTTGGCACAGAGTGG + Intergenic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126421832 15:48482558-48482580 GGACAGTGCCTGGCTCCATCTGG - Intronic
1126693653 15:51307971-51307993 GCACAGTGCCTGGCACAGTCAGG + Intronic
1127258484 15:57310537-57310559 GGAAAGTGCCTGGAACAAGCCGG + Intergenic
1127381490 15:58434384-58434406 GTGGAGTGCCTGGCACATGCTGG - Intronic
1127716149 15:61651125-61651147 GCACAGTGCCTGGCACCAACAGG + Intergenic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127918323 15:63473525-63473547 TCAGAGTGCCTGGCACAAAGTGG - Intergenic
1127974185 15:63985084-63985106 GCACAGATCCTGGCACAGACTGG - Intronic
1128159251 15:65412539-65412561 GCACAGTGCCTGACACAGAATGG + Intronic
1128216793 15:65940007-65940029 GCACAGTGTCTGACACATACTGG - Intronic
1128623957 15:69180287-69180309 GAGCAGTGCCTGGCATAAAATGG - Intronic
1128741512 15:70087145-70087167 GAGCAGTGCCTGGCCCATACTGG - Intronic
1128836382 15:70812318-70812340 GTACAGTGCCTGATACAGAGCGG - Intergenic
1128888886 15:71313011-71313033 GAACAGTGCCTGGCATATAACGG + Intronic
1129109208 15:73327931-73327953 GGACAGTGCCTGGGACAGGCAGG + Intronic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1130010756 15:80151902-80151924 GAATAGTGCCTGGCATATACAGG - Intergenic
1130136865 15:81188809-81188831 GCATAGTACCTGACACAAACTGG - Intronic
1130673543 15:85933178-85933200 GCACAGCGCCTGGCACAAAGTGG + Intergenic
1130726032 15:86440531-86440553 GCACATTGCCTGGAATAAACTGG - Intronic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131435499 15:92418491-92418513 GTAGAGTGCCTGGCACATGGAGG + Intronic
1131676490 15:94675358-94675380 GCACAGTGCCTGGTACCCACAGG - Intergenic
1131867396 15:96726022-96726044 GAACAGTCTCTGGCACAAAGTGG + Intergenic
1132885076 16:2178981-2179003 GGACAGCGCCCGGCAGAAACTGG - Exonic
1133293200 16:4736301-4736323 ACACAGTGCCTGGCACTAACAGG + Intronic
1133603509 16:7363543-7363565 GCAAAGTGCCTGGCATAAAATGG + Intronic
1134065345 16:11224795-11224817 GAACAGTGGCTGGCACACAGCGG - Intergenic
1134133703 16:11666571-11666593 GAACAGTGCCTGCCACACAGTGG - Intergenic
1134586486 16:15416046-15416068 GGACAGTGCCTGGCACATAGTGG + Intronic
1134780921 16:16894977-16894999 GCACAGTGCCTGGCACAGCAAGG + Intergenic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1135100452 16:19600591-19600613 GATCAGTGCCTGGCACACAGGGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135520120 16:23170108-23170130 GAACAGTGCCTGGCACACAATGG - Intergenic
1135877129 16:26213078-26213100 GCACAGGGCCTGGCACTTACAGG - Intergenic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1137411253 16:48230210-48230232 GCACAGTGCCTGGCACATGTAGG + Intronic
1137536413 16:49330107-49330129 GAACAGTGCCCGGTACAAAGAGG + Intergenic
1137540532 16:49358653-49358675 GTGCAGGGCCTGGCACCCACGGG + Intergenic
1137730379 16:50685273-50685295 GCACAGTGCCTGCCACATAGTGG + Intergenic
1137745708 16:50818636-50818658 GTGAAGTGCCTGGCACACTCAGG - Intergenic
1137919085 16:52467966-52467988 GTACAGTGCCTGGCAGTAGTAGG - Intronic
1137966687 16:52941722-52941744 GTACAATGCCTGGCACATAATGG + Intergenic
1138040827 16:53664544-53664566 GAACAGTACCTAGCACTAACTGG + Intronic
1138070868 16:53991914-53991936 CTACAGTTCCTGGCAGCAACTGG - Intronic
1138155072 16:54695514-54695536 GTGCAGAGCCTGGCTCAAAGTGG - Intergenic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG + Intronic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138582210 16:57949035-57949057 GAACAGTGCCTGGTACACAGTGG - Intronic
1139185506 16:64801490-64801512 GTGCAGTGCCTGGCTCAACATGG - Intergenic
1139417519 16:66825902-66825924 GTGCTGTGCCTGGCAGAAACTGG + Intronic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139814238 16:69654703-69654725 GAACAGTGCCTGGCACATGGAGG - Intronic
1139829886 16:69788809-69788831 GAACAGTGCCTGACACATAGTGG + Intronic
1139926665 16:70491904-70491926 GAACTGTGCCTGGCACATCCAGG - Intronic
1139932269 16:70537678-70537700 ATACAGTGCCTGGCACAGTTAGG - Intronic
1140756877 16:78075670-78075692 GTGCAGTGCCTGCCACACGCTGG - Intergenic
1141361538 16:83399818-83399840 GCACAGTGCCTCACACAAGCAGG + Intronic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1141610529 16:85178683-85178705 GAACAGTGCCTGGGACACAGTGG - Intronic
1141670360 16:85488513-85488535 GTTCAGTACCTGGCAGGAACAGG - Intergenic
1141686077 16:85570749-85570771 CTCCAGGGCCTGGCACCAACAGG - Intergenic
1142194635 16:88733761-88733783 GGTCAGTGCGGGGCACAAACGGG + Intronic
1142897713 17:2992681-2992703 GCCCAGTGCCTGGCACACAGCGG + Intronic
1143019463 17:3909353-3909375 GCACAGTGCCTGGCACTCAGTGG + Intronic
1143043204 17:4055044-4055066 GTACTGTCCCTGGCACTTACAGG + Intronic
1143274383 17:5699471-5699493 GCACAGTGCCTGGCACTGATAGG + Intergenic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1145889975 17:28407473-28407495 GCACAGTGCCTGGCACGTAAGGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146184960 17:30718767-30718789 GCACAGTGCCTGGCACAAGCAGG - Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146455182 17:33004239-33004261 GCATAGTGCCTGGCACAGAGTGG + Intergenic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1147497200 17:40928041-40928063 GCACAATGCCTGGCACCATCGGG + Intronic
1147771450 17:42870932-42870954 GAACAGTGCCTGACACATAGTGG + Intergenic
1147988069 17:44317917-44317939 GCACGGTGCCTGGCACAGGCAGG + Intronic
1148340643 17:46871566-46871588 CCACAGTGCCTGGGACAAGCAGG - Intronic
1148522008 17:48286005-48286027 GTACAGTGCTTAGCACATAAAGG + Intronic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149424663 17:56543488-56543510 GAACAGTGCCCGGCACATAGTGG + Intergenic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149964518 17:61148348-61148370 GAACAGTGTCTGGCACATAATGG - Intronic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150397762 17:64834743-64834765 GAACAGTGTTTGGCACAGACTGG + Intergenic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1150851285 17:68705959-68705981 GAACAGTGCCTGACACATAGTGG + Intergenic
1151311989 17:73298802-73298824 GTACAGTGCTTGGCACGCAGCGG - Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1152019160 17:77771524-77771546 GCACAGAGCCTGGCACATGCCGG + Intergenic
1152257343 17:79247939-79247961 GCACAGTGCCTGGCCCACAATGG + Intronic
1152257353 17:79247983-79248005 GCACAGTGCCTGGCCCACAATGG + Intronic
1152348278 17:79768257-79768279 GCACAGGGCCTGGCACACAGTGG + Intergenic
1152974196 18:197398-197420 GTACAGTGTTTAGCACAAATTGG + Intronic
1153165906 18:2261987-2262009 GAACATTGCCTGGCACACAAAGG + Intergenic
1153625897 18:7022199-7022221 GTACAGTGTCTGGGAAATACCGG + Intronic
1153807494 18:8721880-8721902 GAACAGTGCCTGGCACATGCTGG + Intronic
1155284445 18:24273435-24273457 GTACAGTACCTGGCACATTTAGG - Intronic
1155391461 18:25341903-25341925 GTACAGTGCCTGGGATAAGACGG + Intronic
1156448127 18:37251838-37251860 GCCCAGTGCCTGGCACAAGAAGG + Intronic
1156463334 18:37333845-37333867 GAACAGGGCCTGGCACACAGAGG - Intronic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1157232814 18:45935142-45935164 GAACAGTCCCTGGCACAGACTGG - Intronic
1157415937 18:47502873-47502895 GTCCAGTGCCTGGCACATAGTGG - Intergenic
1157456945 18:47840044-47840066 GAAAAGTTCCTGGTACAAACAGG + Exonic
1157526848 18:48389812-48389834 GTACAGTGCCTGGCACGAAGAGG + Intronic
1157539682 18:48491548-48491570 GAACAGTGCCTAGCACATAGTGG - Intergenic
1157873575 18:51251688-51251710 CTACAGTGCCTGGCCCCATCTGG + Intergenic
1157885962 18:51366845-51366867 GTACAATGCCTGTTACAAACTGG - Intergenic
1157916240 18:51666647-51666669 CAACAGTGCCTCGCACAAGCAGG - Intergenic
1158028999 18:52939591-52939613 GCAAAGTGCCTGGCACATAATGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158622868 18:59047839-59047861 GGACAGCGCCTAGCACAAAATGG - Intergenic
1159334136 18:67041953-67041975 GCACAGTGCCTGCCTCAAATTGG - Intergenic
1160114608 18:76065531-76065553 GCACAGTGCCTGGCACAGGGTGG + Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1162326119 19:10000717-10000739 GCACAGTGCCTGACACAAGCAGG + Intronic
1162873250 19:13601499-13601521 GCACAGGGCCAGGCACAAATTGG - Intronic
1162973815 19:14196922-14196944 GCACAGCGCCTGGCACAAGCAGG + Intronic
1163598971 19:18236727-18236749 GTACAGGGCCTGGCACACAGTGG + Intronic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164616055 19:29667382-29667404 GCACAGTGTCTGGCACACAGTGG + Intronic
1165723552 19:38096650-38096672 GTCCAGTGCATGGCATAACCTGG + Intronic
1166099121 19:40560521-40560543 GAACAGTGCCTAGCACACAGAGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166857331 19:45789218-45789240 GAACGGTGCCTGGCACAGAACGG + Intronic
1166937485 19:46343206-46343228 GAGCAGTGCCTTCCACAAACGGG - Exonic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1166992058 19:46698498-46698520 GTACAGTGCCTGGCATACAGAGG + Intronic
1167124390 19:47539213-47539235 GCACAGGGCCTGGCACAGAGGGG + Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168459319 19:56540054-56540076 GCTCAGTGGCTGGCACAAAGTGG - Intronic
1168641151 19:58032599-58032621 GAACAGTGCCTGGTACACATAGG + Intergenic
925742032 2:7014242-7014264 ATACAGTCCCTGGCACAGAATGG + Intronic
925755600 2:7128739-7128761 GTACAGTGTCTGGCATACAGAGG - Intergenic
925968371 2:9087739-9087761 GTTCAGTGACTGGCCCATACTGG - Intergenic
926307841 2:11652109-11652131 GTAAAATGCCTGGCACAGAGTGG - Intergenic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926979450 2:18552374-18552396 GCAAAGTGTCTGGCACATACAGG - Intergenic
927466422 2:23340215-23340237 GCACATAGCCTGGCACACACTGG - Intergenic
927497174 2:23558887-23558909 GAACAGTGCCTGGCAAAGAAGGG - Intronic
928024144 2:27726328-27726350 GTTCAGTGACTGGCCCAACCTGG + Intergenic
928084527 2:28337460-28337482 GTACAGTGCCTGACACAGTGTGG + Intronic
928098805 2:28422951-28422973 GAACAGTGCCTAGCACAAATAGG - Intergenic
928124251 2:28604970-28604992 GCACAGTGCCTGGCACTAGTAGG - Intronic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
928943269 2:36749496-36749518 GTAAAGTGCTTGGCACATACAGG - Intronic
928945695 2:36770168-36770190 GAACAGTGCCTGACACATAGTGG - Intronic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
930035091 2:47080260-47080282 GTACAGGGCCTGGTGCAAGCTGG + Intronic
930758171 2:55000538-55000560 GCACAGTGCCTTGCTCAGACTGG - Intronic
931127287 2:59292248-59292270 GGACAGTGCCTGGCAAATATTGG + Intergenic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931264769 2:60650844-60650866 CTACATTGCCTGGCATGAACAGG + Intergenic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
931633855 2:64324808-64324830 GCACAGTGGCTGGCACACAGCGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932219550 2:69989409-69989431 GGACAGTGCTTGGCACAGAGGGG + Intergenic
932621551 2:73267520-73267542 GAACAGTGCCTGGCACCTAGAGG - Intronic
933369904 2:81401309-81401331 CTAAAGTGACTGGCACAAAATGG - Intergenic
934745038 2:96753695-96753717 GTACCGTGCCTGGAAGAAAGAGG + Intergenic
934762524 2:96864460-96864482 AGGCAGGGCCTGGCACAAACTGG + Intronic
934864589 2:97794847-97794869 GAACAGTGGCTGGCACACAGTGG + Intronic
935622483 2:105142186-105142208 GTACAGTGTCTGGCACAAAATGG - Intergenic
936340841 2:111631253-111631275 GTGCAGTGCCTGGTGCAAAGTGG - Intergenic
936466278 2:112754023-112754045 GCACAGTGCCTAGCACACATAGG + Intronic
936512456 2:113159093-113159115 GAATAGTGCCTGGGACATACAGG - Intronic
936520130 2:113206682-113206704 GAACAATGCCTGGCACAGAAGGG + Intronic
936620129 2:114087226-114087248 ATACAATGCCTGGAACACACAGG - Intergenic
936938709 2:117861074-117861096 GCATAGTGGCTGGCACACACTGG + Intergenic
937085596 2:119169804-119169826 TCAAAGTGCCTGGCACAAGCCGG + Intergenic
937299470 2:120830335-120830357 GCATAGTGCCTGGCACATAGGGG + Intronic
937333482 2:121046208-121046230 GCACAGTCCCTGGCACATTCAGG + Intergenic
937399224 2:121567236-121567258 GGACAGTGCCTGGCCCACAGCGG - Intronic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
938841619 2:135170489-135170511 GTACTGTACCTGACACAAAGTGG - Intronic
939045797 2:137248375-137248397 GTACAGTGTCTGGCACATGGTGG + Intronic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940539033 2:154986958-154986980 GAACAATGCCTGGCACAGATAGG + Intergenic
940749061 2:157603365-157603387 GTACAGTGCCATGCACATAGTGG - Intronic
941014457 2:160338891-160338913 GGCCAGTGCCTGGCACAAATAGG - Intronic
941279768 2:163535405-163535427 GAACAGTGCTTGGCACAGAGTGG + Intergenic
941362657 2:164571631-164571653 GCTCAGTGCCTGGCACATAATGG - Intronic
941790911 2:169550792-169550814 GCCCAGTGCCTGACACAACCAGG + Intronic
942067056 2:172281310-172281332 ATATGGTGCCTGGCACACACTGG + Intergenic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942398723 2:175578902-175578924 GCACAGTGCCTGGCACTTAGTGG - Intergenic
942517018 2:176765084-176765106 GTACAGTGCCTGAAATAAAATGG + Intergenic
942781633 2:179650032-179650054 GCACAGAGCCTGGCACAAGGCGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943667607 2:190626584-190626606 GTACAATGCCTGCCACCCACAGG - Intergenic
944318317 2:198307115-198307137 GCCCAGTGCCTGGCACACAGTGG - Intronic
944483147 2:200177794-200177816 GCACAGTGCCTGGCATATATTGG + Intergenic
946095888 2:217273785-217273807 GCACAATGCCTGGCACAAGTGGG + Intergenic
946174711 2:217915492-217915514 GAACAGTGCCTGGCACTGAGGGG + Intronic
946260135 2:218482385-218482407 GCCCAATGCCTGGCACTAACAGG - Intronic
946324012 2:218973763-218973785 GAATAGTGCCTGGCACATAAAGG + Intergenic
946497294 2:220207396-220207418 GTACAGTGCCTGGAAGAAAGTGG + Intergenic
946724598 2:222649932-222649954 GTACAGTGCCTGGTATAAGGTGG - Intronic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
947711391 2:232318428-232318450 GTGCAGTACCTGGCACTAATAGG - Intronic
947946755 2:234110394-234110416 GGACAGTGCCTGGCACCTAGTGG - Intergenic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948634143 2:239323542-239323564 GCACAGTGCCTTCCACACACAGG - Intronic
1168794572 20:602921-602943 GCACAGTGCCTGCCACACAGAGG + Intergenic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1168971711 20:1935746-1935768 GTCCAGTGCGTGGCACACAGTGG - Intronic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1170042640 20:12054140-12054162 GGAGAGTGTCTGGCACATACTGG + Intergenic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1170813021 20:19689543-19689565 CAGCAGTGCCTGGCACAAAATGG + Intronic
1171017003 20:21551154-21551176 GCACAGTGCATGGCACACAGAGG - Intergenic
1171023643 20:21609344-21609366 GCACAGTGACTAGCACACACAGG - Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172052774 20:32131869-32131891 GAACAGTGCCTGGCACAGCATGG - Intronic
1172164515 20:32890884-32890906 GCATAGTGCCTGGCACATAGTGG + Intronic
1172601110 20:36183548-36183570 GCCCAGTGTCTGGCACAAACAGG - Intronic
1172608416 20:36231393-36231415 GAATAGTCCCTGGCACAAGCAGG - Exonic
1172740525 20:37162904-37162926 TTACAGTGACAGGCACAAAGCGG + Intronic
1172750885 20:37250341-37250363 GAACAGTACCTGGCACAGAGTGG + Intergenic
1172888706 20:38248578-38248600 GCACAGGACCAGGCACAAACAGG + Intronic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1172955111 20:38750971-38750993 GTACAGTGCCTGGCACGTAATGG + Intronic
1173096893 20:40041980-40042002 GTACAGTTCTTGGCATAACCTGG + Intergenic
1173104113 20:40115976-40115998 GTATAGTGTCTGGCACATAGTGG + Intergenic
1173161637 20:40657211-40657233 GCACAGTGCCTGGCACAAGGTGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173345975 20:42200366-42200388 GCACAGTGCCTCGCACATAGTGG + Intronic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173518642 20:43682897-43682919 GGACAGTGCCTTGCACACAGTGG + Intronic
1173583364 20:44163182-44163204 GAACAGTGCCTGGTACACAGAGG + Intronic
1173606857 20:44337668-44337690 GTGCAGTGCCTGGCGCACAGTGG - Intronic
1173812127 20:45962373-45962395 GCACAGAGCCTGGCACAGAGTGG - Intronic
1173957376 20:47044341-47044363 GAACAATGCCTGGCACACAGTGG - Intronic
1174047154 20:47741594-47741616 GAACAGTGCCTGGCACGCAGTGG + Intronic
1174175278 20:48640688-48640710 GTACAAGGCCTGGCACAAGCTGG + Intronic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174422553 20:50409090-50409112 GTGCAGTGCCTGGGACAAGCTGG + Intergenic
1174485589 20:50859333-50859355 GAACAGTGCCTAGCTCACACAGG - Intronic
1174504614 20:51009293-51009315 GAACAGTGTCCAGCACAAACAGG - Intronic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1174621013 20:51874645-51874667 GAACAGTGCTGGGCACAAATAGG + Intergenic
1174687145 20:52466904-52466926 GAACAGTGCCTAACACAAAATGG - Intergenic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1175448129 20:59040487-59040509 GAACAGTGGCTGACACATACTGG + Intronic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1176951913 21:15057863-15057885 GCACAATGTCTGGCACAAAACGG + Intronic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178344339 21:31812016-31812038 ATATAGTGACTGGCACAAAGTGG - Intergenic
1178610038 21:34072797-34072819 GGACGGTGCCTGGTACACACAGG - Intergenic
1178751634 21:35309767-35309789 GCACAGTTCCAGGCACAAAATGG + Intronic
1178848973 21:36197497-36197519 GCACAGTGCCTAGAACAAAGCGG - Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179839506 21:44062266-44062288 GAACAGTGCCTGGCACATGGTGG - Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180090045 21:45529248-45529270 GTACAGGGCCGGGCACATCCAGG + Intronic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181876601 22:25945414-25945436 GTCCAGTGCCTGGCACTGAATGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182114334 22:27746689-27746711 GCACAGTGCCAGGCACAGAGGGG - Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182794324 22:32979696-32979718 GAACAGTACCTGGCACATACTGG - Intronic
1182966716 22:34528499-34528521 ATACAGTGCTTGGCACACACAGG - Intergenic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183234416 22:36606534-36606556 GGACAGTGCATGGCATAATCTGG + Intronic
1183251982 22:36736849-36736871 GCACAGTGCCTGGCACCAAAAGG + Intergenic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183401206 22:37605686-37605708 GTGAAGGGCCTGGCCCAAACTGG - Intergenic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183934111 22:41252397-41252419 ATGCAGTGCCTGGCAGAAAATGG + Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184349873 22:43936487-43936509 GGACAGGGCCTGGCACATACTGG + Intronic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
1184427759 22:44423222-44423244 GTGCAGGGCCTGGCACACACTGG + Intergenic
1184451342 22:44584494-44584516 GAACAGTGCCTGGCACCAAGTGG + Intergenic
1184483355 22:44761072-44761094 GTACAGGGCCTGGTACATGCAGG - Intronic
949119139 3:364496-364518 ATACAGTGCTTGGCCCAAAATGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950121483 3:10484973-10484995 GCACAGTGCCTGGCACTGACAGG + Intronic
950528610 3:13539541-13539563 GCACAGTACCTGGCACAGAGTGG + Intergenic
951041188 3:17990336-17990358 GAACAGTGCCTGGCACTATTTGG + Intronic
951807985 3:26667776-26667798 GTGTTGTGCCTGGCAAAAACAGG + Intronic
951809656 3:26685238-26685260 GTACTGTGCCTGGCCCACATGGG + Intronic
952041138 3:29263340-29263362 GTATAGTGCCTGACACATATAGG - Intergenic
952933486 3:38377386-38377408 GCACAATGCCTGGCACCAAATGG - Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953134594 3:40171773-40171795 GCACAGTGCCTTGCACATAGTGG - Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953375461 3:42424475-42424497 CTACAGTGCCTGGCACATGGTGG - Intergenic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
955046626 3:55367113-55367135 GAACAGTGCCTATCACAAACTGG + Intergenic
955065112 3:55527070-55527092 GCACAGTGCCTGGCACTAGGAGG + Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955666235 3:61351902-61351924 GAACAGTGGCTGGCACATAGTGG - Intergenic
955676377 3:61453195-61453217 GCACTGTCCCTGGCACAAAGTGG + Intergenic
955742563 3:62107785-62107807 GTACATTGGCTAGCACAAATAGG - Intronic
956052627 3:65264934-65264956 TTACAGTGCCTGCCACATAGAGG + Intergenic
956246990 3:67194835-67194857 CAACAGTGTCTAGCACAAACCGG + Intergenic
956516934 3:70060186-70060208 GCACAGTGCCTGGCATGAAGTGG - Intergenic
956681763 3:71787610-71787632 TCACAGTGCCTGGAACAGACTGG + Intergenic
956904533 3:73752165-73752187 GGACAGTGCCTGGCACAAAAAGG + Intergenic
956906002 3:73766060-73766082 GCACAGAGCTTGGCACACACAGG - Intergenic
957033554 3:75271573-75271595 GTACAGTGCCTAGCACTTAGGGG - Intergenic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
957724032 3:84041657-84041679 GAACAGTGACTGGCACATAGTGG - Intergenic
959903196 3:111682983-111683005 ACACAGTACCTGGCACAAAAGGG - Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
960915894 3:122694496-122694518 GCACAGTGCCTGGCACATCGTGG + Intronic
960986585 3:123284955-123284977 TCACAGTGCCTGGCACGAGCAGG - Intronic
961583742 3:127904685-127904707 GATCAGTGCCTGACACAAGCAGG + Intergenic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962198593 3:133383446-133383468 GCACAGTGTCTGGCACACAATGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962331837 3:134485493-134485515 GCACAGAGCATGGCACCAACTGG + Exonic
962468728 3:135686390-135686412 GCACAGTGTCTGGCACAAGCAGG - Intergenic
962883932 3:139605556-139605578 GCACAGAGCCTGGCACATTCTGG - Intronic
962886409 3:139632101-139632123 GCACTGTGCCTGGCACCAATAGG + Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963064732 3:141254347-141254369 GAATAGTGCCTGGCACTTACTGG + Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963138740 3:141930791-141930813 GCACAGTGCCTAGCACACAGTGG - Intergenic
963227532 3:142877519-142877541 GCACAGTGCTTGGCACAAGCAGG - Intronic
963350991 3:144150756-144150778 GTGAAGTACCTGGCACATACTGG + Intergenic
963900481 3:150728157-150728179 GCCCAGGGCCTGGCACAAATGGG - Intergenic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964632215 3:158823801-158823823 GTCCAGTTCCTGGCACAGAAAGG + Intronic
964714531 3:159708083-159708105 GAACAGTGCCTGACACAAAGTGG + Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
967017417 3:185494820-185494842 GAACAGTGCCTGGCACCAGCAGG - Intronic
967229332 3:187322731-187322753 GAATAGTGCCTGGCACCAAAAGG - Intergenic
967440091 3:189497353-189497375 GTACAGTGCCTGGAATAGAGCGG - Intergenic
968083056 3:195860194-195860216 CTTCAGTGCCTGGGACAAGCCGG + Intergenic
968273928 3:197425451-197425473 GCACTGTGCCTGGCACAAGTGGG + Intergenic
968526205 4:1058829-1058851 GGACTGTGCCTGGCATACACAGG + Intronic
968717053 4:2168100-2168122 GTACAATGCCTGGGACATAGTGG - Intronic
968793507 4:2686360-2686382 GCACAGGGCCTGGCACATATTGG - Intronic
969296323 4:6272236-6272258 GCACAGTGCTTGGCACAAGATGG + Intronic
969925203 4:10578937-10578959 ATAAAGTGCCAGGCACAAACTGG + Intronic
970341977 4:15116899-15116921 GCACAGTGCCTGGCACCCAGTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970480509 4:16468134-16468156 GAACAGTATCTGGCAAAAACAGG + Intergenic
970891352 4:21048603-21048625 GAACAGTGGCTGGTACACACTGG + Intronic
970982384 4:22115006-22115028 GGACAGTGCCTGGAACACAGTGG + Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
972299633 4:37772613-37772635 GCACAGTGCCTGGCACAAGATGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972645998 4:40967863-40967885 GCACAGTGCCTGGGACATAATGG + Intronic
972672956 4:41231537-41231559 GTGCAGTGCATGGCACAAGTAGG + Intergenic
973553387 4:52057528-52057550 GCCCAGTGCCTGGTACATACTGG - Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
974154164 4:58048862-58048884 TTACAGTGTCTGGCACAAGTAGG + Intergenic
974185245 4:58437085-58437107 TAAGAGTGCTTGGCACAAACTGG + Intergenic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976096035 4:81509332-81509354 GAAAAGTGCCTGGCACAGATAGG + Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
976521212 4:86029441-86029463 GCAGAGAGCCTGGCACAAATAGG + Intronic
976531421 4:86157488-86157510 GTATAGTGACTGGTGCAAACTGG - Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
977466469 4:97388005-97388027 GCACAGTTCCTGACACATACTGG + Intronic
977650418 4:99462313-99462335 GGACAGTGCCTGTCACTGACTGG + Intergenic
977792400 4:101123229-101123251 GGATAGTGCCTGGCACATAGGGG + Intronic
978499049 4:109388845-109388867 GTAGAGTGTCTGGCACATAAAGG + Intergenic
978541819 4:109824640-109824662 GTACAGTGCCTGGCACTCTGTGG + Exonic
979227744 4:118308810-118308832 GAACAGTGCCTGGCATACAGAGG + Intronic
979614832 4:122731255-122731277 GAATAGTGCCTGGCAAAAATAGG + Intergenic
979625495 4:122840400-122840422 GCACAGTTCCTGCCACAAATAGG - Intronic
980240347 4:130165379-130165401 TTACAGTGACTGGCACACAGTGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980907289 4:138960973-138960995 GTACAAAGCATGGCATAAACTGG + Intergenic
981582745 4:146266948-146266970 GAAGAGTGCCTGGCACATAATGG - Intronic
981627911 4:146781168-146781190 GTATAGTGTCTGGAACAAAAAGG + Intronic
981697472 4:147573460-147573482 GCACAGTGCCTAGCACAAAGTGG - Intergenic
982062587 4:151619705-151619727 GAACAGTGCCTGGCATATATTGG - Intronic
982227635 4:153180900-153180922 GGACAATGCCTGGCACAAGCAGG - Intronic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
982982896 4:162163982-162164004 GTTCAGTGACTGAGACAAACTGG - Exonic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
983873324 4:172847630-172847652 GGATAGTGCCTGGCCCATACGGG - Intronic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984559225 4:181249294-181249316 GCACAGTGTCTGGCACAGAAGGG - Intergenic
985038332 4:185863263-185863285 CGACATTGCCTGGCACACACAGG - Intronic
985361344 4:189178989-189179011 GGACAGAGCCTGCCACAGACCGG - Intergenic
986619408 5:9656143-9656165 GCACAGTACCTGGCACATATAGG + Intronic
986641452 5:9875786-9875808 TTACAGTGATTGGCATAAACTGG + Intergenic
987879284 5:23720712-23720734 GAATAGTGCCTGGCACATAGAGG + Intergenic
988377122 5:30451340-30451362 GTCTAGTGCCTGGTACAAAATGG - Intergenic
988686145 5:33527314-33527336 TTTCAGTGTCTGGCAGAAACTGG + Exonic
989101925 5:37831347-37831369 GGACAGTGCCTGGCACAGACAGG + Intronic
989189033 5:38651837-38651859 GAATAGTGCCTGGCACAAGGAGG + Intergenic
989356522 5:40549748-40549770 GAACAGTGCCTGGCACTTAGTGG - Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
990632022 5:57680786-57680808 GTTCAAGGCCTGGCACACACAGG - Intergenic
991441806 5:66658686-66658708 GTACAGTGTCTGGCACCCAGGGG - Intronic
991446720 5:66707981-66708003 GTAAAGAGTCTGGTACAAACAGG - Intronic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991725403 5:69530929-69530951 ACACAGTGTCTGGCACAAATCGG - Intronic
992131218 5:73694824-73694846 TTACAGTGCATGGCACTAAATGG - Intronic
992754567 5:79892195-79892217 GAACAGTGCCTAGCATAAAGTGG - Intergenic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
993436668 5:87904206-87904228 GCACAGTGCCTGGAACAAAGTGG - Intergenic
993448400 5:88043178-88043200 GTACAGTGCCTGACATACAATGG + Intergenic
993661366 5:90640513-90640535 GTACAGTGCTTGGCAGGCACAGG + Intronic
993925769 5:93864022-93864044 TTACAGTGTCTGGCACATAGTGG - Intronic
994313839 5:98308892-98308914 GAACAGTGCCCAGCACATACAGG - Intergenic
995783134 5:115799049-115799071 GTGCAGTGTCAGGCACAATCTGG + Intergenic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
996572159 5:124944017-124944039 GAACAGTGCCTGTCACACAATGG + Intergenic
996580422 5:125026218-125026240 ATACAGTATCTAGCACAAACGGG + Intergenic
996597302 5:125220053-125220075 GTACAGTGGCTTGCATAAATAGG + Intergenic
997280486 5:132640939-132640961 GCCCAGGGCCTGGCACCAACTGG - Intronic
997835357 5:137187622-137187644 GCACAGTGCCTGGTACACGCTGG - Intronic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
997879807 5:137579508-137579530 GTACAGGGCCTGGCATATAGTGG - Intronic
998156471 5:139789669-139789691 GAACAGTGCCTGGCACCCAGTGG - Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998606246 5:143638017-143638039 ATACAGTGCCTGGCACCTAAAGG - Intergenic
998672756 5:144372379-144372401 GTACAGTGACTGGCATAAATAGG - Intronic
998775448 5:145595529-145595551 GTCCAGTGCCTGGCACACTGAGG - Intronic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999099318 5:149009533-149009555 GCTCAGTGCCTGGCACAGACTGG + Intronic
999512122 5:152263151-152263173 TTTCAGTGGCTGGGACAAACTGG + Intergenic
1000046355 5:157524955-157524977 GAACAGTTCCTGTCACACACTGG - Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1000507152 5:162135468-162135490 GCACAGTGCCTGGGACATAGAGG - Intronic
1000829883 5:166089732-166089754 GTAATGTGACTGACACAAACTGG - Intergenic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001445549 5:171779902-171779924 GGATAGTGCCTGGCTCAAACTGG - Intergenic
1001557846 5:172648423-172648445 GAACACTGTCTGGCACAGACGGG - Intronic
1001566264 5:172701388-172701410 GAACAGTGCCTGGCACGTAGTGG + Intergenic
1001576260 5:172765931-172765953 GTAAAGTGCCTGGCACACAGTGG - Intergenic
1001740853 5:174051616-174051638 GCACAGTGCCTGGCTCACAGAGG - Intronic
1001741472 5:174056340-174056362 GCACAGTGCCAGGCACATAGTGG + Intronic
1002324111 5:178394294-178394316 GAACAGTGCCTGCCACACACTGG + Intronic
1002512080 5:179727179-179727201 TGACAATGCCTGGCACAAAATGG - Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1003128334 6:3373883-3373905 GGACAGTGCCTGGCACGTAGTGG - Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003940302 6:11017856-11017878 GAACAATGCCTGGCACATAATGG + Intronic
1004438636 6:15624107-15624129 GCACAGTGCCTGGTACATGCTGG - Intronic
1005091865 6:22065492-22065514 GTCCAGTACCTGGCACATAGAGG - Intergenic
1006500330 6:34454719-34454741 GAACAGTGCCTGGGACACAGTGG + Intergenic
1006737189 6:36282620-36282642 ATACAGTGCCTGGCACTCACAGG - Intronic
1006751102 6:36377728-36377750 GCACAGTGACTGACACAAGCTGG - Intronic
1006923237 6:37639793-37639815 GAACAGTGCCTGGCATATAATGG + Intronic
1007105072 6:39278193-39278215 GTCCAGGGCCTGGCACAAATAGG + Intergenic
1007850544 6:44798714-44798736 GTACAGTGCTTGGAACATAGAGG + Intergenic
1008014751 6:46505845-46505867 GCTTAGTGCCTGGCACATACAGG + Intergenic
1008321322 6:50117752-50117774 GTAAAGTGCCTGGCACAGTGTGG + Intergenic
1008951365 6:57163393-57163415 GCACAGTGTTTGGCACAAAATGG + Intronic
1011270159 6:85570275-85570297 GTCCAGTACCTGGCACATACTGG - Intronic
1011296009 6:85827101-85827123 GTGCAGGCCCTGGCACCAACAGG - Intergenic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1011720914 6:90155855-90155877 GAACAATGCCTGGCACAAGCAGG + Intronic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012841807 6:104338225-104338247 GTACAGTGCCTAGCACATAGTGG + Intergenic
1013441074 6:110169840-110169862 GTACAATGCCTAGCATATACAGG + Intronic
1013548474 6:111183450-111183472 GCGCAGTGCCTAGCACACACTGG + Intronic
1013551541 6:111212244-111212266 GTAAAGTGCCTAGCCCAGACTGG + Intronic
1013604456 6:111734857-111734879 GCACAGTGCCTGTCACATAAAGG - Intronic
1014013954 6:116508213-116508235 GCACAGTACCTGGCACACAGTGG + Intronic
1014032829 6:116726087-116726109 GCACAGTGCCTGACACATAATGG + Intronic
1014624212 6:123705697-123705719 GTGCTATGCATGGCACAAACTGG - Intergenic
1014635962 6:123846902-123846924 GTACAGTGCCTGGAATAGAGTGG - Intronic
1014652655 6:124059575-124059597 CTACAGTTCCTGGCACAGAGTGG + Intronic
1014937805 6:127404434-127404456 GAACAGTGCCTGACACATACAGG + Intergenic
1015183108 6:130382250-130382272 GCACAGTGTGTGGCACAAAGTGG + Intronic
1015257119 6:131190964-131190986 ATACTGTGCTTGGCACATACAGG + Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1016013918 6:139165043-139165065 GCACAGTACCTGGCACATAAAGG - Intronic
1016257409 6:142124383-142124405 GTACAGTGCCTGATACACATGGG - Intergenic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1016526551 6:145007757-145007779 GAGCAGTACCTTGCACAAACTGG + Intergenic
1016597791 6:145821001-145821023 GAACAGTGCCTGGCACATGTGGG + Intergenic
1016902397 6:149115298-149115320 GGACACTGCCTGGCACATCCTGG + Intergenic
1017014634 6:150090134-150090156 GCACAGTGCCTGGCACACGGTGG + Intergenic
1017220419 6:151960024-151960046 GAACAGTTCCTGACACATACTGG + Intronic
1017540514 6:155397505-155397527 GAACAGTGCCTGGCATACAGTGG + Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1017943292 6:159072578-159072600 GCACAGTGCCTGACACATAGTGG - Intergenic
1018213187 6:161502168-161502190 GTGCAGTGCATGGCCCAAAATGG - Intronic
1018220771 6:161576549-161576571 TAATAGTGCCTGGCACAAAGTGG - Intronic
1019120574 6:169800861-169800883 CTGCAGGGCCTGGCACACACAGG - Intergenic
1019399604 7:844724-844746 GAACAGTGCCTGGCGCAGAGTGG - Intronic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1020385156 7:7592853-7592875 GTCCACAGCCTGGTACAAACTGG - Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022470662 7:30680258-30680280 GTGCAGTGGCTGGCACATAGTGG + Intronic
1022966786 7:35481567-35481589 GCACAGTGCCTGGCACATGGTGG + Intergenic
1023162224 7:37308649-37308671 GCACAGTACCTGGCACACACTGG + Intronic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1024332828 7:48173369-48173391 GAACAGTGCCTGGCACACAATGG + Intronic
1024380879 7:48694948-48694970 GGAGAGTGCCAGGCACACACGGG - Intergenic
1024621652 7:51163419-51163441 GCACAGTGCCTAGAACAGACAGG + Intronic
1024633831 7:51270414-51270436 GAACAGTGCCTGGCACGTAGTGG - Intronic
1025026259 7:55518679-55518701 GGATAGTGCCTGGCACACAGCGG - Intronic
1025248272 7:57334362-57334384 GTGCAGTGCCTGGGACAAGCTGG - Intergenic
1026771386 7:73202747-73202769 GCACAGTGCCTGGCACACATGGG + Intergenic
1027012252 7:74756144-74756166 GCACAGTGCCTGGCACACATGGG + Intronic
1027075788 7:75189910-75189932 GCACAGTGCCTGGCACACATGGG - Intergenic
1028978743 7:96943336-96943358 GTACCGTGCCTGGCCCAAATTGG - Intergenic
1029022325 7:97377894-97377916 GCACAGTGCCAGGCAGAATCAGG - Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030299253 7:107959054-107959076 GAACGGTGCCTGGCACATAGAGG + Intronic
1031127817 7:117794061-117794083 GAACAGTGGCTGGCACACAGTGG + Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1031979381 7:128114959-128114981 GCCCAGTGCCTGGCACACAGTGG + Intergenic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032162576 7:129522091-129522113 GCCCAGTACCTGGCACACACAGG - Intergenic
1032470233 7:132173021-132173043 GTAGAGTGCCTGGCACATAATGG - Intronic
1032633167 7:133676152-133676174 GAACAGTGCCTGGTACATAACGG - Intronic
1032662833 7:134004745-134004767 GCATAGTGTCTGGCACAAATAGG + Intronic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033822522 7:145151294-145151316 GATCAGTGCCTGGCACATAGTGG + Intergenic
1033836889 7:145325385-145325407 GAATAGTGCCTGGCAAAACCAGG - Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034259182 7:149743912-149743934 GCATAGTGCCTGGCACATTCTGG - Intergenic
1035103898 7:156425729-156425751 GAACAGTGCCTGGCAAAGAATGG - Intergenic
1035424604 7:158760835-158760857 ATCCAGTGCCTGGCACACCCAGG + Intronic
1035651746 8:1271356-1271378 GCACAATGCATGGCACACACTGG + Intergenic
1036040391 8:5073137-5073159 GGACAGTGCTTGGAACAAACAGG + Intergenic
1036062088 8:5334878-5334900 GTTCAGTGGCTGGCACTACCAGG - Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1036492548 8:9241427-9241449 GTACAGTGCCTGGTGCACAGTGG - Intergenic
1036616263 8:10390143-10390165 GTACAGAGACTGGCACAGCCTGG - Intronic
1037706472 8:21319684-21319706 GTACAGTGCCTGGCACATGGTGG - Intergenic
1037750882 8:21681586-21681608 GAACAGTGCCTGGCAGAGAGTGG - Intergenic
1037939169 8:22938596-22938618 GTACAGTGCCTGGGACCAGCAGG + Intronic
1038075247 8:24065950-24065972 ATAGAGTGCCTGGCACATAGGGG + Intergenic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1038332251 8:26618225-26618247 GCAAAATGCCTGGCACACACTGG - Intronic
1038515043 8:28180848-28180870 ATTCAGAGCCTGGCACAGACAGG - Intronic
1038529679 8:28308177-28308199 GCATGGTGCCTGGCACTAACAGG + Intergenic
1038751713 8:30302157-30302179 GAACAGTGCCTGTCACAGACGGG + Intergenic
1038905576 8:31898323-31898345 GCACAGTTCCTGGCACATAGTGG - Intronic
1039331994 8:36547655-36547677 GTACAGTGTCTGACACATACTGG + Intergenic
1040016980 8:42707869-42707891 GAACAGTGCCTGGCCCATAGTGG - Intronic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1040048534 8:42988659-42988681 GCACAATGCCTGAGACAAACAGG - Intronic
1040425888 8:47285867-47285889 GGACAGTGCCTAGCACACAGTGG + Intronic
1040650016 8:49437048-49437070 GCACAGTGCCTGGCACAACGTGG + Intergenic
1041015938 8:53593537-53593559 GTACGGTGCCTGAGACCAACTGG - Intergenic
1041914428 8:63125733-63125755 GGACACTGCCTGGCACATAAGGG + Intergenic
1042018476 8:64343837-64343859 GAATAGTGTCTGGCACAAAGTGG - Intergenic
1042221199 8:66476463-66476485 CTATAGTGCCTGGCACATAGGGG - Intronic
1042246658 8:66714892-66714914 GGACAGTGCCTGGCACGTGCAGG + Intronic
1042723175 8:71845580-71845602 GTACAGTGACGGGCACACAGCGG - Intronic
1042837408 8:73091128-73091150 GCACAGGGCCTGGCACAAGCAGG + Intronic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1043621266 8:82195224-82195246 GTACAGTGTCTGGTTCAAACAGG + Intergenic
1043919380 8:85963609-85963631 GAATAGTGCCTGGCACAGAGTGG + Intergenic
1044941246 8:97346108-97346130 GTACAGTGCTTTGCACAGAGTGG + Intergenic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1046096882 8:109573106-109573128 GTACAGCACCTGGCACATAGTGG - Intergenic
1046614621 8:116462511-116462533 TTACAGTGCCTGGCCCATAGTGG - Intergenic
1046760227 8:118012730-118012752 GTAAATTGCCTGGCACATAATGG + Intronic
1047125980 8:121961114-121961136 GTACAGTGTCTGGCACACAATGG - Intergenic
1047221018 8:122918280-122918302 TTGCAGTGCCTGGCACACATGGG - Intronic
1047226416 8:122958838-122958860 GCACAGGGCCTAGCACAAAGAGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047434687 8:124826366-124826388 GGAGAGTGCCTGGCACCACCGGG - Intergenic
1047818613 8:128493609-128493631 GTAAGGAGCCTGGCAGAAACAGG - Intergenic
1048235633 8:132687317-132687339 GAAGAGTGCCTGGCACAAAGTGG - Intronic
1048366826 8:133745606-133745628 GCATGGTGCCTGGCACAGACTGG + Intergenic
1048487778 8:134864859-134864881 GTGCAGTTCCTGGCATAGACTGG + Intergenic
1048688572 8:136932858-136932880 GCACAGTGCCTGGTACAAAAGGG + Intergenic
1048863266 8:138739631-138739653 GGACAGTGCCTGCCACACAGTGG + Intronic
1049835725 8:144734364-144734386 GTCTAATCCCTGGCACAAACCGG + Intronic
1050089408 9:2001507-2001529 GCACAGTGCCAGTCACAAAAGGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050296455 9:4210063-4210085 GTATAATGCCTGGCACATAGTGG + Intronic
1050463430 9:5896273-5896295 GCCCAGTGCCTGGCACAAATTGG + Intronic
1050504451 9:6332859-6332881 GCACATTGCCTGGCACTATCAGG - Intergenic
1051051283 9:12934678-12934700 GCACAGTTCCTGGCACAAGTTGG + Intergenic
1051114097 9:13674356-13674378 GTACAGTGCCTGGAACATAGTGG + Intergenic
1051741229 9:20254359-20254381 GCACAGAGCCTGGCACACAGTGG - Intergenic
1051909555 9:22137908-22137930 ATACAGTGCCTGGCACATATAGG - Intergenic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1052409516 9:28105333-28105355 GAACAGTGCCTAGCACAAACAGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053162249 9:35821224-35821246 GCACAAGGCCTGGCACAAAATGG + Intronic
1053384820 9:37678697-37678719 GAACAGTGCCAGGCACATAGAGG + Intronic
1053422044 9:37985860-37985882 GGACAGTGCCTGGCGCAGGCAGG - Intronic
1054980809 9:71203730-71203752 GTACAGTGCCTGGAACAGTATGG + Intronic
1055543309 9:77338569-77338591 GTACAGTGCCTCCCAGACACAGG + Intronic
1056532115 9:87497491-87497513 GCACCGTGCCCGGCACAAGCTGG + Intronic
1056694038 9:88831243-88831265 GTATGGAGCCTGGCACACACTGG + Intergenic
1057196641 9:93119276-93119298 GCACAGGGCCTAGCACATACAGG + Intergenic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057872420 9:98728470-98728492 GCACAGTGCCTGGCACATGGAGG - Intergenic
1057891874 9:98875739-98875761 GCCCAGTGCCTGGCACACAGAGG - Intergenic
1058103694 9:100946037-100946059 TGACAGTGCCTGGCACAGAGTGG - Intergenic
1058120972 9:101138367-101138389 GTGTAGTACCTGGCACCAACAGG + Intronic
1058262218 9:102848811-102848833 GTTCAGTGCCTGGCACATCTTGG + Intergenic
1058552057 9:106125215-106125237 GTACAGTCCCCAGCACATACAGG - Intergenic
1059145912 9:111898916-111898938 GAACAGTGCCTTGCACAAAACGG - Intronic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1059485651 9:114624663-114624685 GTTAAGTGCCTGGCACAGAGTGG - Intronic
1059505788 9:114798694-114798716 GTACAGACCCTGGCACATATTGG + Intronic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1059609849 9:115880672-115880694 GCACAGGGCCAGGCACATACTGG + Intergenic
1059664344 9:116431693-116431715 GTACAGTTTCTGGCACATAGTGG - Intronic
1059774713 9:117463554-117463576 GCCCAGTGCCTGGCACACAGTGG - Intergenic
1059904835 9:118971062-118971084 TTACAAGGCCTGGCATAAACTGG - Intergenic
1060019767 9:120119002-120119024 GCCCAGTGCCTGGCACAAAGTGG + Intergenic
1060145881 9:121252053-121252075 TTACAGTGCCTGGTACATAGTGG - Intronic
1060171392 9:121464223-121464245 GCACAGTGCCTGGTACATAGTGG + Intergenic
1060236208 9:121864621-121864643 GCTCAGTGCCTGGCACACATGGG + Intronic
1060302743 9:122384871-122384893 GCACAGTGCCTGGCATAAGACGG - Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060688314 9:125632373-125632395 GTCAAGTCCCTGGCACATACAGG + Intronic
1060802425 9:126553260-126553282 ATACAGGGCCTGGCACAAGTAGG - Intergenic
1061002995 9:127913008-127913030 GAACAGTGGCTGGCGCAGACTGG + Intronic
1061011307 9:127956210-127956232 GAACAGGGCCTGGCACACACTGG - Intronic
1061206810 9:129168975-129168997 GCACAGTGCCTGGCATATATAGG + Intergenic
1061219796 9:129243561-129243583 GGACAGTGCCTGGCACATGAGGG + Intergenic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061934785 9:133851340-133851362 GTATAGTGCCTGGCACACAGTGG - Intronic
1185996758 X:4959916-4959938 GCTCAGTGCTTGGCACAAATAGG + Intergenic
1186443609 X:9607132-9607154 GCCCAGGGCCTGGCACACACAGG - Intronic
1186633519 X:11377205-11377227 GCATAGTGCTTGGCACAAAATGG + Intronic
1187237657 X:17483553-17483575 GCACAATGCCTGACACAAACAGG - Intronic
1188696894 X:33204682-33204704 GCACAGTACCTGGCACAAAATGG + Intronic
1189169423 X:38894742-38894764 GCACAGTGCCTGACACATGCTGG - Intergenic
1189173687 X:38933344-38933366 AGATAGTGCCTGGCACACACTGG - Intergenic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1189351269 X:40277562-40277584 GTAGAGTGGCTGGCACAGAGTGG + Intergenic
1189985114 X:46546348-46546370 GAACAGTGTCTGGCACCAGCTGG - Intergenic
1189995089 X:46630465-46630487 GCACAGTGGCTGGCACATGCAGG - Intronic
1190236198 X:48617537-48617559 GCACAGTGCCTGGCACATGTAGG - Intergenic
1190454614 X:50615574-50615596 GCACAGTGCCCGGCACACAGTGG + Intronic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1191724937 X:64269342-64269364 GTAAAGTGCCTAGCACATAGAGG - Intronic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192270205 X:69571951-69571973 GCACAGGGCCTGGCACACAGTGG + Intergenic
1192276796 X:69640355-69640377 GTACACTTCCTGGCACATAGTGG + Intronic
1192546619 X:72019518-72019540 GAACAGTGCCTGACACACAGTGG + Intergenic
1192794662 X:74416999-74417021 GTACAGAGCCTGACACATAGAGG + Intergenic
1192833155 X:74771853-74771875 GTACAGTACCTGGCTCATAGTGG + Intronic
1193195070 X:78621893-78621915 GTTCAGTGCCTGGCACATAATGG - Intergenic
1194752314 X:97698637-97698659 GAACAGTGTCTGGCACATAATGG + Intergenic
1195050495 X:101092128-101092150 GAACAGTGCCTAGCACAAGGAGG + Intronic
1195083237 X:101390488-101390510 GAACAGTGCCTGCCACATAATGG + Intronic
1195599509 X:106729184-106729206 GTAGAGTGCCTGGCATATAGTGG - Intronic
1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG + Intronic
1196262884 X:113606037-113606059 GTACTGTGCATGGCACATAGCGG - Intergenic
1196934967 X:120720467-120720489 GAACAGTGCCTGGCAAAGACGGG + Intergenic
1197593327 X:128436497-128436519 ATAAAGTGCCTGGCACATAATGG + Intergenic
1197703217 X:129615619-129615641 GCACTGTGCCTGGCACACAATGG - Intergenic
1197846279 X:130806964-130806986 GTACAGTGCCTAACACATATGGG + Intronic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197881666 X:131172984-131173006 GAACAGTGCCTGGAACACAGTGG - Intergenic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1198428755 X:136545403-136545425 GCACAGTGCCTAGCACATAGTGG - Intronic
1198511471 X:137356146-137356168 GCAAAGTGCCTGGCACATAGTGG + Intergenic
1198585424 X:138115466-138115488 GGACAGTGCCTGGCACCGAGCGG - Intergenic
1199383618 X:147199103-147199125 GTACAGTGCCTTTCACAAGGAGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200274947 X:154723272-154723294 GCACAGTGTCTGGCACATAGTGG - Intronic
1201594756 Y:15655765-15655787 GAACAGTGTCTGGCACAGAATGG + Intergenic
1201678368 Y:16614175-16614197 GCTCAGTGCTTGGCACCAACAGG - Intergenic
1201771836 Y:17623205-17623227 ACACAGTCCATGGCACAAACAGG + Intergenic
1201829719 Y:18282781-18282803 ACACAGTCCATGGCACAAACAGG - Intergenic