ID: 1157142518 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:45124186-45124208 |
| Sequence | ACAGCTCAATACCTTAGCAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 107 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 99} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1157142518_1157142520 | 28 | Left | 1157142518 | 18:45124186-45124208 | CCATTGCTAAGGTATTGAGCTGT | 0: 1 1: 0 2: 0 3: 7 4: 99 |
||
| Right | 1157142520 | 18:45124237-45124259 | AAATGAAAGAGTTTAAACCCAGG | No data | ||||
| 1157142518_1157142521 | 29 | Left | 1157142518 | 18:45124186-45124208 | CCATTGCTAAGGTATTGAGCTGT | 0: 1 1: 0 2: 0 3: 7 4: 99 |
||
| Right | 1157142521 | 18:45124238-45124260 | AATGAAAGAGTTTAAACCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1157142518 | Original CRISPR | ACAGCTCAATACCTTAGCAA TGG (reversed) | Intergenic | ||