ID: 1157142519

View in Genome Browser
Species Human (GRCh38)
Location 18:45124217-45124239
Sequence TTTTATATTCTACTTAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157142519_1157142521 -2 Left 1157142519 18:45124217-45124239 CCATATTTAAGTAGAATATAAAA No data
Right 1157142521 18:45124238-45124260 AATGAAAGAGTTTAAACCCAGGG No data
1157142519_1157142522 2 Left 1157142519 18:45124217-45124239 CCATATTTAAGTAGAATATAAAA No data
Right 1157142522 18:45124242-45124264 AAAGAGTTTAAACCCAGGGTTGG No data
1157142519_1157142520 -3 Left 1157142519 18:45124217-45124239 CCATATTTAAGTAGAATATAAAA No data
Right 1157142520 18:45124237-45124259 AAATGAAAGAGTTTAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157142519 Original CRISPR TTTTATATTCTACTTAAATA TGG (reversed) Intergenic