ID: 1157142521

View in Genome Browser
Species Human (GRCh38)
Location 18:45124238-45124260
Sequence AATGAAAGAGTTTAAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157142518_1157142521 29 Left 1157142518 18:45124186-45124208 CCATTGCTAAGGTATTGAGCTGT No data
Right 1157142521 18:45124238-45124260 AATGAAAGAGTTTAAACCCAGGG No data
1157142519_1157142521 -2 Left 1157142519 18:45124217-45124239 CCATATTTAAGTAGAATATAAAA No data
Right 1157142521 18:45124238-45124260 AATGAAAGAGTTTAAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157142521 Original CRISPR AATGAAAGAGTTTAAACCCA GGG Intergenic